A system for the detection and typing of Human Papillomavirus of the lower genital tract: In situ hybridization screening and polymerase chain reaction confirmation. 

Gloria Premoli¹, Ivan Galindo-Castro², José Luis Ramírez³. 

¹Centro de Investigaciones Odontológicas, Facultad de Odontología, Universidad de Los Andes, Mérida. ²Gerencia Nacional de Biotecnología, Cervecería Polar C.A., Caracas e ³Instituto de Estudios Avanzados IDEA. Caracas, Venezuela. Correo electrónico: premoli@ula.ve 

Abstract. We developed a simplified and non-isotopic in situ hybridization procedure for the detection of Human Papillomavirus (HPV) in routine Papanicolaou cervical smears. The assay involves one oligonucleotide (malignant probe) which recognizes high risk HPV 16 and 18, and another which detects HPV 6 and 11 (benign probe). We adapted the system to fulfill the requirements of gynecologists and cytologists, assimilating their protocols and simplifying the in situ hybridization assay. When we compared the detection levels reached by the in situ hybridization versus a ladder PCR assay in 156 clinical samples, original designed for this work, the kappa coefficient between both methods is 0.945, indicating a strong agreement between the ISH and the PCR assays. 

Key words:  Diagnostic, typing, HPV, in situ hybridization, polymerase chain reaction, lower genital tract. 

Sistema de detección y tipificación de Papilomavirus del tracto genital inferior: Hibridización in situ y confirmación con reacción en cadena de la polimerasa.

Resumen. Se desarrollo un procedimiento de Hibridación in situ no-isotópico y simplificado para la detección de papilomavirus humano (HPV) en citologías de rutina de Papanicolaou. El ensayo involucra un oligonucleotido (sonda maligna) el cual reconoce a los VPH de alto riesgo: 16 y 18, y otra que detecta VPH 6 y 11 (sonda benigna). Se adaptó completamente el sistema a los requerimientos de ginecólogos y citotecnólogos, asimilando sus protocolos y simplificando el ensayo de hibridación in situ. Se compararon 156 muestras clínicas, los niveles de detección tanto en hibridación in situ como en el ensayo de PCR (diseño original para este trabajo), se obtuvieron valores de co-positividad y co-negatividad cercanos a la unidad (> 0,98). 

Palabras clave:  Diagnóstico, tipificación, VPH, hibridización in situ, reacción en cadena de la polimerasa, tracto genital inferior. 

Recceived: 24-11-2004. Accepted: 07-07-2005. 

INTRODUCTION 

The human papillomavirus (HPV) has been associated with the genesis of human cancer (1-3). Out of the 100 identified viral types (4-6), a fourth them preferentially infects the mucosal epithelium lining of the anogenital tract, and types 16, 18, 31, 33, 35 and 45 are considered as high risk viruses by their close association with all grades of squamous intraepithelial lesions (SIL) and invasive cancers (7-9). Types 6 and 11, coexist with benign Condylomata acuminata (venereal warts) and low-grade of SIL (10), and are generally treated as low risk viruses. 

The common test for the analysis of HPV-lesions is the Papanicolaou stain, commonly known as the Pap Smear (PS), this method combines simplicity and accurateness, but owing to its low sensitivity it is only reliable on acute viral infections (11). Another handicap of this technique is the lack of reproducibility, the results fluctuate from one laboratory to another, and although efforts are made to refine the staining procedure (12, 13) a standardized protocol is not widely applied. Finally, the PS is not sufficiently predictive on HPV-induced neoplasias. In fact, Lörincz y col. (14) showed that 25% of patients with advanced in situ carcinoma, presented normal PS a few years before diagnosis. Therefore, new diagnostic tools for the early detection of high-risk HPV are needed (15). Such assays will permit the physician to reveal the presence of high-risk HPV when no damage to the host cell is yet apparent, and establish a close surveillance in those patients. The methods develop to detect HPV by immunocytochemistry have single type poor sensitivity and do not discriminate between viral types. Gupta y col. (16) showed that only 57% of the biopsies with clear morphological alterations were positive for this type of test. In addition, a cell culture system to produce large quantities of HPV antigens is not yet available. 

The in situ hybridization techniques (ISH) although somewhat laborious, fulfill these needs. Using whole DNA probes and non-radioactive labeling, HPV was detected in infected cells in culture (17-19) and in preserved tissue specimens (20-22). 

Recently, with the availability of the DNA sequences of most HPV types, it is possible to choose specific oligonucleotides to perform ISH in PS. The use of oligonucleotides in ISH has several advantages: a) the specificity of the assay can be increased by focusing on specific targets and removing sequences in common with other viral types. b) Smaller DNA probes have a better penetration in cell tissues, and hence, easier protocols can be designed. c) they can be labeled to a very high specific activity, thus improving the assay’s sensitivity. 

Although the use of polymerase chain reaction (PCR) in the diagnosis of HPV permits the detection of a few viral copies in complex samples (13, 23-25), it does not show the virus location, and demands especial skills. 

In this work we used a new ISH on PS to detect the most common HPVs infecting the anogenital tract. The assay combines the use of short oligonucleotides labeled to a high specific activity, with a simplified handling of the samples. We also designed a ladder multiplex-PCR protocol to independently assess the presence of HPV in the PS samples examined. 

MATERIALS AND METHODS 

HPV clones and clinical specimens 

Cloned genomes of HPV types 6b, 11, 16, and 18 were a generous gift from Drs. H. zur Hausen and E. de Villiers (Heidelberg, Germany). The present series consisted of 156 clinical samples collected from patients attending the Gynecology Service of a large, urban, municipal oncological reference center, Hospital Oncológico Padre Machado, and from a private clinic at Caracas (Urológico San Román). Cervical scrapes from endo-and exo-cervix were taken with a sterile round-cotton tip, and the adhered cells were circularly spread on a pre-cleaned slide (micro slides, Superfrost, VWR Scientific), covering an area of about 1.5 cm diameter. The cells were fixed and the cotton swab was immersed in an Eppendorf tube containing IX phosphate buffered saline (PBS) and 0.02% sodium azide. The samples were kept at –20°C until use. 

Sequence analysis and oligonucleotide designing and selection 

We used the software DNAsis v7 (Hitachi) to analyze the HPV sequences retrieved from the GenBank database, and to select the specific oligonucleotides used in the ISH and PCR assays. 

From the DNA sequence analysis, we selected oligonucleotide 1 (benign probe): 5´ GAACTTATTACCAGTGTTATACAG G 3´, for the detection of HPV 6 and 11, and oligonucleotide 2 (malignant probe): 5´ ATATCAGATGACGAGRACGAAAAT G 3´ (R being Adenine or Guanine), for HPV 16 and 18. The sequence of oligonucleotide 1 is located within the L1 open reading frame (ORF) of 6b and 11, beginning at positions 6326, respectively. Oligonucleotide 2 is contained within ORF E1 of HPV 16 and 18, beginning at positions 961 and 1007, respectively. To test the specificity of these oligonucleotides, we hybridized them against whole genomic DNAs from HPV 6, 11, 16 and 18, blotted onto nylon filters. 

Labeling of oligonucleotides and whole HPV genomes for ISH 

We labeled the oligonucleotides probes as follows: to 200 ng of each oligonucleotide, we added a reaction mixture containing 140 mM potassium cacodylate, 30 mM tris base pH 7.2, 1 mM CoC12, 0.1 mM dithiotreitol (DTT), 0.1 mM digoxigenin-11-dUTP, 25 units of 3”-exo nucleotidyl transferase (Boehringer Mannheim), and adjusted the final volume to 25 µL. The reaction mixture was incubated for 1.5 h at 37°C. When whole viral genomic probes were used, we separated the viral genome-containing inserts from the cloning vectors by restriction enzyme digestion and by agarose gel electrophoresis. The purified inserts were labeled by random priming using digoxigenin-11-dUTP Genius labeling and detection kit (Boehringer Mannheim) according to the manufacture’s instructions. 

ISH protocol 

We washed the PS with 95% ethanol for 15 min, and refixed them with 4% paraformaldehyde in 1X PBS (Phosphate-buffered saline) for 15 min at 37°C. The remaining liquid was removed and the slides were air dried at 37°C. We incubated the samples with 0.2N HCI (Hydrochloric acid) for 15 min at 25°C and washed them with 2X SSC (Saline-sodium citrate buffer) (20X SSC is 3 M Na-citrate, pH 7.0) at room temperature for 15 min. We transferred the slides to a covered plastic micro-pipette tip box that we used as hybridization chamber (hybridization box). Each sample was covered with 100 µL of prehybridization solution (eX SSC, 2% blocking reagent, Boehringer Mannheim), 20% formamide (v/v), 0.1% N-lauroylsarcosinate (w/v), 0.02% SDS (sodium dodecyl sulfate) (w/v), and incubated in the hybridization chamber at 37°C for 1 h. 

After prehybridization, we added 30 µL of fresh hybridization solution containing the appropriate labeled oligonucleotide at a final concentration of 40 ng/mL, and covered the sample with a coverslip, sealing the edges with nail enamel. 

We reincubate the samples at 92°C in the hybridization box, placed in a boiling water bath, for 10 min, and at 37°C for 1 h. After hybridization, we immersed the slides in a staining jar with 6 X SSC solution at room temperature and carefully detached the coverslips. The following washes were applied: one with 6 X SSC at 48°C for 15 min and a final wash with 2 X SCC at room temperature for 15 min. 

The detection was accomplished with a Gen detection kit from Boehringer Mannheim following the manufacture’s indications. In general, the color reaction was allowed to proceed up to 6 h, but overnight development yielded good results as well. After stopping the color reaction with TE (Tris/EDTA) (10 mM Tris-HCl, 1 mM EDTA (ethylenediamine tetraacetic acid), pH 7.5), we dehydrated the samples with graded ethanol (from 70% to 99%). The contrast can optionally be increased by eosin counter staining. 

We mounted the samples with permount and observed them by light microscopy at 40 X magnification. A positive result was observed as dark-blue or purplish aggregations within the cell nuclei. As positive controls we used in HeLa cells. 

Polymerase chain reaction 

Frozen cervical swabs embedded in PBS were thawed, drained, and the cotton tips discarded. The remaining solution was centrifuged for 30 sec in a microcentrifuge eppendorf, the supernatant discarded, and the cell pellet resuspended in 10 to 20 µL of lysis solution (10 mM Tris-HCL, pH 7.5, 0.1% sodium laurylsarcosinate, 100 g/mL proteinase K). This was followed by incubation for 1 h at 56°C and, finally, the proteinase was inactivated by incubation at 95°C for 20 min. We cleared the lysates with 5 sec centrifuged in a microcentrifuge, and took 1 to 3 µL samples to do the PCR. The mixture contained: 1 mM of each dNTP; 200 µM of each primer (see Table I); 2 units of Taq DNA polymerase in 1X reaction buffer (10mM This HCL, pH 8.3; 50 mM potassium chloride; 1.5 mM MgCl₂; 100 g/mL gelatin) in a final volume of 25 µL. An overlay of mineral oil (30 µL) was used to avoid water loss during the thermal cycling. The thermal cycler (Ericomp or Eppendorf) was programmed as follows: one cycle of 5 min at 94°C; a second cycle of 1.5 min at 54°C and 1.5 min at 72°C and 1.5 min at 94°C (repeated 35 times), and a last cycle of 10 min at 72°C. We electrophoresed the PCR products (10 µL) in a 2% agarosa gel, this gel was stained with ethidium bromide and observed under a 330 nm ultraviolet transilluminator. As positive controls we performed the PCR assay on genomic DNA of HPV 6b, 11, 16, and 18 or mixture of them, and in HeLa cells. As negative control we used purified human leucocyte DNA.

TABLE I

PRIMERS AND TARGETS USED TO PERFORM THE HPV PCR ASSAY 

 

Kappa coefficient 

It was used to estimate the agreement between PCR and ISH as classifiers of the level of risk of HPV; Cohen JA, (26). The interpretation of the kappa coefficient was done using the classification provided by Landis y col. (27). These values were done using Epi Info 6.04 Dean y col. (28). 

RESULTS 

Selection and specificity of the oligonucleotide probes 

As expected (Fig. 1), the mixture of both oligos (“universal” probe) detected the four viral types, whereas the “malignant” probe only reacted with HPV 16 and 18. No reactions was observed with mixed with cellular DNA.

In situ hybridization 

The ISH protocol described in Materials and Methods permitted us to detect HPV risk groups in routine PS preparations. In Fig. 2 we show the results of several ISH experiments. When we used whole genomic probes (included for comparative purposes) on a negative sample (Fig. 2A) and positive one (Fig. 2B), although a difference is observed, we found it difficult to distinguish between samples. On the contrary, the use of digoxigenine-labeled oligoprobes produced a higher contrast. An extreme result is presented in Fig. 2C and D, where oligonucleotides 1 and 2 respectively, were used in HeLa cells. No color reaction was observed as expected with oligo 1, whereas a strong reaction embodying the whole cell was observed with oligo 2. Fig. 2E shows a positive result when used oligonucleotide 2 in a PS from a patient suffering an invasive carcinoma, and Fig. 2F shows another positive sample. In both cases, we observed dark purples aggregations within the cell nuclei with additional cytoplasmic color depositions. A negative sample show in Figure 2G shows no color aggregation within cells.

Polymerase chain reaction 

Every sample analyzed by ISH was confirmed by PCR assay. This PCR assay simultaneously detects the presence of HPV types: 6, 11, 16 and 18, in such a way that the viral type can be deduced by the size of its products (multiplex PCR). Table I shows the primers used, their respective target and the sizes of the amplified products. Fig. 3 shows the result of doing the multiplex PCR in a mixture of cloned viral genomes, and two samples of human DNA from negative patients. This approach spared us from the cumbersome confirmation of each viral type by DNA hybridization (29).

Fig. 4 shows the PCR results in several cervical swabs, the smaller DNA band, common to all samples (except for lanes 10 and 11), is the positive control of the PCR, and is the product of the amplification of a target within the human ribosomal genes (30). In lanes 2, 3, 4 and 5 we show the result of patients infected with HPV 6b, 11, 16 and 18, respectively. In lane 6, we present another patient infected with HPV 16.

In lane 7, 8, 9 and 12 four negative samples are shown whereas in lane 10 the PCR failed as indicated by the lack of the human ribosomal amplification product. Lane 11 shows the absence amplification when no DNA is added (carry-over- control). 

In Table II we summarized the results of ISH and PCR in 156 studied samples, where we obtained a kappa coefficient of 0.945 showing a strong agreement between PCR and ISH, the 95% confidence interval contains values from 0.728 to 1.000.

TABLE II

CORRELATION BETWEEN IN SITU HYBRIDIZATION AND PCR ASSAYS ON A SAMPLE OF 156 PATIENTS 

                 Agreement between ISH and PCR methods: 0.945 (kappa coefficient). 

DISCUSSION 

The ISH presented here is compatible with the routine cytology/histology laboratory, and detects HPV genomes in cervical smears with a higher predictive value than the PS. The sensitivity values of ISH are due in part to the amplification power of the microscope, which allows the direct observation of the color hybridization signal within the infected cell. This fact permits establishing a straight association of the viral genome with the epithelial cell origin, an observation which is a very important for the oncologist. The digoxigenine-labeled oligonucleotides used as probes, render a clear and not shown hybridization signal when compared with labeled whole genomes and can discriminate between low risk and high risk viral types in a fast hybridization reaction. Comparing the reaction described here, we could do the screening and the typing of the same HPV by PCR. 

Although new anogenital-associated HPV types are discovered each year, HPV 16 (31) and, to a lesser extent, HPV 18 (32) have been found in the majority of the cases of cervical or vulvar malignancy (33-36). In Venezuela, we found (37-40) that nearly 80% of the cases of high grade squamous intraepithelial lesions (SIL) and malignants lesions, contained HPV 16 or 18 DNA sequences. 

Although PCR is a very sensitive technique, with a crucial role in diagnostics of human pathogens (41), its high sensitivity is also its major disadvantage. For this reason, extreme sample manipulation precautions must be taken to avoid carry-over contaminations. Nevertheless, using the reaction described here, we could do the screening and the typing of the HPV in a single reaction, reducing the number of samples and the experimental time, as well as the associated costs. In addition, a comparison of the yields of the PCR products with those of the PCR internal control (rDNA), makes it possible to obtain an idea of the extent of the infection (42). For instance, the sample of lane 2, Figure 4, seems to have more copies of the HPV6 genome than the sample of lane 12. 

The kappa coefficient between both methods is 0.945, indicating a strong agreement between the ISH and the PCR assays. Our ISH could be compatible with the mass screening required at hospitals and cancer reference centers, and the fact that it can detect high risk viral genomes ahead of any clinical symptom enhances the predictability and diagnostic potential of the traditional PS. In addition, the detection of high risk infections can reduce the costs of diagnosis, since only in these group of patients, the test must be time spaced by shorter periods. 

Even when the traditional methods as Papanicolaou cervical smears, it continues being a valuable tool for the screening of VPH, it is important to emphasize that we adapted the system to fulfill the requirements of gynecologist and cytologists, assimilating their protocols and simplifying the in situ hybridization assay, when we compared the detection levels reached by in situ hybridization versus a ladder PCR assay. 

ACKOWLEDGEMENTS 

The oligonucleotide sequences used in this work are claimed by the USA PTO Utility Patent Serial No 07/820,412. This study was supported by FONACIT S1-2000000475, F1-2001001203, and C.D.C.H.T. O-047-97-07-C, C.D.C.H.T. 0-123-05-07-A and C.D.C. H.T. 0-124-05-07-F. I am indebted to Rafael Borges, Anajulia Gonzalez and Juana Villarreal for their co-operation and revising the manuscript. 

REFERENCES 

1. zur Hausen H. Papillomavirus as carcinomaviruses. Adv Viral Oncol 1989; 8:1-6.         [ Links ]

2. zur Hausen H. Papillomaviruses and cancer: From basic studies to clinical application. Nat Rev Cancer 2002; 2:342-350.          [ Links ]

3. Ojeda J, Ampuero S, Rojas P, Prado R, Allende J, Barton S, Chakraborty R, Rothhammer F. p53 codon 72 polimorphism and risk of cervical cancer. Biol Res 2003; 36: 279-283.          [ Links ]

4. De Villiers EM. Heterogeneity of the human papillomavirus group. J Virol 1989; 63: 4898-4903.         [ Links ]

5. Taweed A, Beaudenon S, Favre M, Orth G. Characterization of human papillomavirus type 66 from an invasive carcinoma of the uterine cervix. J Clin Microbiol 1991; 29:2656-2660.          [ Links ]

6. Muñoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, Snijders PJ, Meijer CJ. International Agency for Research on Cancer Multicenter Cervical Cancer Study Group. Epidemiologic classification of human papilomavirus types associated with cervical cancer. N Eng J Med 2003; 348: 518-527.          [ Links ]

7. Hørding U, Iversen A, Sebbelov A, Bock J, Norrild D. Prevalence of human papillomavirus types 11, 16 and 18 in cervical swabs. A study of 1362 pregnant women. Eur J Obstet Gynecol Reprod Biol 1990; 35:191-198.         [ Links ]

8. Bosch F, Muñoz N. The viral etiology of cervical cancer. Virus Res 2002; 89: 183-190.          [ Links ]

9. Schiffman M, Castle P. Human papillomavirus. Epidemiology and Public Health. Arch Pathol Lab Med 2003; 127:930-934.          [ Links ]

10. Arends M, Wyllie A, Bird C. Papillomaviruses and human cancer. Hum Pathol 1990; 164:1991-1993.          [ Links ]

11. Burk R, Kadish A, Calderin S, Romney S. Human papilloma infection of the cervix detected by cervicovaginal lavage and molecular hybridization: correlation with biopsy results and Papanicolaou smear. Am J Obstet Gynecol 1986; 154:982-989.          [ Links ]

12. Schulte E. Standardization of the Papanicolaou stain I. A comparison of five nuclear stains. Anal Quant Cytol Histol 1990; 12:149-156.          [ Links ]

13. Goodman A. Role of routine human papillomavirus subtyping in cervical screening. Curr Opin Obstet Gynecol 2000; 12:11-14.          [ Links ]

14. Lörincz A, Lancaster W, Temple G. Cloning and characterization of the DNA of a new human papillomavirus from a woman with dysplasia of the uterine cervix. J Virol 1986; 58:225-229.          [ Links ]

15. Hubbard RA. Human papillomavirus testing methods. Arch Pathol Lab Med 2003; 127:940-945.          [ Links ]

16. Gupta J, Gupta P, Rosenshein N, Shah K. Detection of human papillomaviruses in cervical smears. A comparison of in situ hybridization, immunocytochemistry, and cytopathology. Acta Cytol 1987; 31:387-391.          [ Links ]

17. Cornelissen M, Van Den Velden K, Walboomers J, Bonët M, Smiths H, Van Der Noorda J, Ter Schegget J. Evaluation of different DNA-DNA hybridization techniques in detection of HPV 16 DNA in cervical smears and biopsies. J Med Virol 1988; 25:105-114.          [ Links ]

18. Crum C, Nuovo G, Friedman D, Siverstein S. A comparison of biotin and isotope-labeled ribonucleic acid probes for in situ detection of HPV 16 ribonucleic acid in genital precancers. Lab Invest 1988; 58:345-359.          [ Links ]

19. Wagner D. Identification of human papillomavirus in cervical swabs by deoxyribonucleic acid in situ hybridization. Obst Gynecol 1984; 64:767-772.          [ Links ]

20. Heilles H, Genersch E, Keesler C, Neumann R, Eggers H. In situ hybridization with digoxigenin-labeled DNA of human papillomaviruses (HPV 16/18) in HeLa and SiHa cells. BioTechniques 1988; 6:978-981.          [ Links ]

21. Margall N, Matias-Guiu X, Chillon M, Coll P, Alejo M, Nunes V, Quilklez M, Rabella N, Prats G, Prats J. Detection of Human Papillomavirus 16 and 18 DNA in epithelial lesions of the lower genital tract by in situ hybridization and polymerase chain reaction: cervical scrapes are not substitutes for biopsies. J Clin Microbiol 1993; 31:924-930.          [ Links ]

22. Kerstens H, Poddighe P, Hanselaar A. A novel in situ hybridization signal amplification method based on the deposition of biotinylated tyramine. J Histochem Cytochem 1995; 43:347-352.          [ Links ]

23. Nuovo G. Human papillomavirus DNA in genital tract lesion histologically negative for condylomata. Analysis by in situ, Southern blot hybridization, and the polymerase chain reaction. Am J. Surg Pathol 1990; 14:643-651.          [ Links ]

24. Rakoczy P, Sterrett J, Kulski J, Whitaker D, Hutchinson L, Mackenzie J, Pixley E. Time trends in the prevalence of human papillomavirus infections in archival Papanicolaou smears: analysis by cytology, DNA hybridization, and polymerase chain reaction. J Med Virol 1990; 32:10-17.          [ Links ]

25. Poljak M, Seme K, Gale N. Detection of human papillomaviruses in tissue specimen. Adv Anat Pathol 1998; 5:216-233.          [ Links ]

26. Cohen J A. coefficient of agreement for nominal scale. Educ Phyc Meas 1990; 20: 37-46.          [ Links ]

27. Lands J, Koch G. The measurement of observer agreement to categorical data. Biometrics 1997; 33:159.         [ Links ]

28. Dean A, Dean J, Coulombier D, Brendel K, Smith D, Burton A, Dicker R, Sullivan K, Fagan R, Amer T. Epi info, version 6: A word- processing, Database, and statiscal program for public health on IBM-compatible Microcomputers. Atlanta: Centers for Disease Control and Prevention. 1995.         [ Links ]

29. Schiffman M, Bauer H, Lörincz A, Manos M, Byrne J, Glass A, Cadell D, Howley P. Comparison of Southern blot hybridization and polymerase chain reaction methods for the detection of human papillomavirus DNA. J Clin Microbiol 1991; 29:573-577.          [ Links ]

30. Premoli-de-Percoco G, Pinto J, Ramírez JL Galindo I. Focal epithelial hyperplasia: human papillomavirus-induced disease with a genetic predisposition in a Venezuelan family. Hum Genet 1993; 91:386-388.          [ Links ]

31. Schneider A, Mainhardt G, de Villiers EM, Grissman L. Sensitivity of the cytological diagnosis of cervical condyloma in comparison with HPV-DNA hybridization studies. Diagn Cytopathol 1987; 3:250-255.          [ Links ]

32. Kataya V, Syrjänen K, Syrjänen S, Mäntyjärvi R, Yliskoski M, Saarikoski S, Salonen J. Prospective follow up of genital HPV infections: survival analysis of the HPV typing data. Eur J Epidemiol 1990; 6:9-14.          [ Links ]

33. de Villiers E, Wagner D, Schneider A, Wesh H, Munz F, Miklaw H, Zur-Hausen H. Human Papillomavirus DNA in women without and with cytological abnormalities: Results of a five-year follow-up study. Gynecol Oncol 1992; 44:33-39.          [ Links ]

34. Hallam N, Gibson P, Green J, Charnock M. Detection and typing of human papillomavirus infection of the uterine cervix by dot blot hybridization: comparison of scrapes and biopsies. J Med Virol 1989; 27:317-321.          [ Links ]

35. Kiviat N, Koutsky L, Critchlow C, Lörincz A, Cullen A, Brockway J, Holmes K. Prevalence and cytologic manifestation of Human Papillomavirus (HPV) types 6,11, 16, 18, 31, 33, 35, 42, 43, 44, 45, 51, 52, and 56 among 500 consecutive women. Int J Gynecol Pathol 1992; 11:197-203.          [ Links ]

36. Lörincz A, Reid R, Jenson A, Greenberg M, Lancaster W, Kurman R. Human papillomavirus infection of the cervix: Relative risk association of fifteen common anogenital types. Obstet Gynecol 1992; 79:328-337.          [ Links ]

37. Azócar J, Menéndez C, Ramírez J, Hernández R, Acosta H, Reumann H, Rincón Morales F, Estévez JA. Detección de virus de papiloma humano en lesiones del cervix en Venezuela. Acta Cient Venez 1988; 39:171-17.          [ Links ]

38. Premoli-de-Percoco G, Ramírez J, Galindo I. Correlation between HPV types associated with oral squamous cell carcinoma and cervicovaginal cytology. Oral Surg Oral Med Oral Pathol 1998; 86:77-82.          [ Links ]

39. Romero J. Aplicación de la técnica de hibridación in situ en la detección del virus del papiloma humano (VPH) en tejidos embebidos en parafina. [Tesis de Grado]. Mérida: Universidad de Los Andes; 2000.          [ Links ]

40. Premoli-de-Percoco G, Ramírez J. High risk human papilomavirus in oral squamous carcinoma: evidence of risk factors in a Venezuelan rural population. Preliminary report. J Oral Pathol Med 2001; 30:355-361.          [ Links ]

41. Erlich H, Gelfand D, Sninsky J. Recent advances in the polymerase chain reaction. Science 1991; 252:1643-651.          [ Links ]

42. Morrison E, Goldeberg G, Kadish A, Burk R. Polymerase chain reaction detection of human papillomavirus: Quantitation a improve clinical utiliy. J Clin Microbiol 1992; 30:2539-2543.          [ Links ]

Corresponding author: Gloria Premoli. Centro de Investigaciones Odontológicas, Facultad de Odontología, Edificio el Rectorado, Universidad de Los Andes, Apartado postal 64. Calle 23 entre Av. 2 y 3, La Hechicera, Mérida 5101, Venezuela. Telephone: 58-0274-240.2388. Fax: 58-0274-240.2438. E-mail: premoli@ula.ve.