INTRODUCTION
Asthma is a major public health problem worldwide. It is a multifactorial disease characterized by chronic airway inflammation, leading to bronchial hyperresponsiveness and airway remodeling 1. Neutrophils and eosinophils are two major pro-inflammatory cell types that play essential role in the pathogenesis of asthma 1-3. So far, few biomarkers have been evaluated to reflect the airway inflammation in the asthmatic patients, but with unsatisfactory sensitivity or reliability.
The apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional key protein initially identified to play an important role in the base-excision repair by recognizing the abasic site 4,5. Besides its DNA repair function, recent studies showed that APE1 also regulates the expression of different transcription factors, notably, the inflammatory pathway regulator NF-κB, thus contributing to inflammation regulation 6. It has been proved that APE1 controls IL -6 and IL -8 expression through its redox function 7. APE1 also regulates inflammatory response in macrophages and keratinocyte 8,9. Indeed, APE1/Ref-1 has been viewed as an emerging therapeutic target for various inflammatory diseases, including inflammatory pain sensitization, murine myocarditis and spontaneous chronic colitis 10-12.
The association between APE1 and asthma has not been established yet. Based on the established association between APE1 and inflammatory diseases, we hypothesized that APE1 may play a role in asthmatic inflammation. To test this notion, we detected the serum APE1 protein expression levels, mRAN levels from neutrophils and eosinophils isolated from peripheral blood in adult asthmatic patients and healthy controls.
PATIENTS AND METHODS
Study subjects
The diagnosed asthmatic patients and healthy controls were enrolled at the Department of Respiration, Shidong Hospital of Yangpu District between March August, 2018 and October, 2020. The diagnosis of asthma was made in line with the criteria of the Global Initiative for Asthma (GINA) and described elsewhere 13. The asthmatic subjects were classified as patients with severe asthma (SA) and patients with non-severe asthma (NSA) by the International European Respiratory Society/American Thoracic Society guidelines 14. Any patient who had known to have underlying respiratory diseases other than asthma was excluded. We also recruited sex and age matched healthy individuals who had annual checkups at our hospital, but did not have any acute or chronic illness (such as cancer, inflammatory diseases, cardiovascular diseases, etc.), atopic diseases or any symptoms of obstructive airway disease. The body mass index (BMI), smoking status, asthma duration (years), allergic history, blood eosinophils and blood neutrophils counts were obtained from their medical charts.
Ethical statement
The ethical committee of Shidong Hospital of Yangpu District approved the study. This research was conducted in accordance with the principles embodied in the Declaration of Helsinki. All participants were given written informed consent forms to participate in the study.
Pulmonary function
Pulmonary function tests were performed using a SYSTEM 21® device (Minato Medical Science Co., Osaka, Japan), according to the criteria of the American Thoracic Society (ATS)/European Respiratory Society and the Japanese Respiratory Society 15. The pulmonary function was measured and included the percentage of predicted volume (FEV1% pred).
Serum samples collection and protein quantification
Peripheral blood was drawn in each participant, followed by centrifugation at 3500 rpm for 10 min to isolate serum. Serum samples were collected and APE1 levels were determined using Human APEX1 ELISA kit (Cusabio, Houston, USA). The optical density (OD) was detected with an EnSpire microplate reader (PerkinElmer, Waltham, USA), at a wavelength of 450 nm with a correction set at 540 nm. The concentration of serum APE1 (pg/mL) was calculated using the standard curve. The serum high-sensitivity C-reactive protein (Hs-CRP) was detected using human high sensitivity C-Reactive Protein ELISA kit (Sunlong Biotech, Hangzhou, China) according the manufacturer’s protocol. The total IgE level was detected using Human IgE ELISA Kit (Abcam Biotech, Waltham, MA, USA) according the manufacturer’s protocol.
RNA isolation and reverse transcription and real-time PCR
Neutrophils and eosinophils were isolated from fresh drawn peripheral blood using the MACSxpress Whole Blood Eosinophil Isolation Kit and MACSxpress Whole Blood Neutrophil Isolation Kit (Miltenyi Biotec Inc., Bergisch Gladbach, Germany), according to the manufacturer’s manual. Total RNA was extracted using the TaKaRa RNA PCR Kit (Takara, Dalian, China) from neutrophils and eosinophils. The expression of APE1 mRNA was performed by quantitative realtime polymerase chain reaction (rt-qPCR) with the SYBR Premix Ex Taq II (Takara, Dalian, China). All samples were performed in triplicate. β-actin was applied for the internal normalization of RNA. The PCR reaction was performed at 95°C for 3 min, followed by 40 cycles of 95°C for 10 s and 61°C for 30 s. The comparative Ct method (ΔCt) was exploited to calculate the relative expression levels of miRs. The mean cycle threshold (Ct) values and deviations between the duplicates were calculated for all samples. The primers for the APE1 were as following: miR-30, Forward: CTGCTCTTGGAATGTGGATGGG, Reverse TCCAGGCAGCTCCTGAAGTTCA. β-actin, Forward AGAGCTACGAGCTGCCTGAC and reverse GGATGCCACAGGACTCCA.
Statistical analysis
The data are expressed in terms of mean (± standard deviation). Student’s t-test and one-way ANOVA were used to compare two or more groups. Pearson’s correlation analysis was conducted and the correlation coefficients (r2) were used to measure correlation. A receiver operating characteristic (ROC) curve was performed to the diagnostic value of serum APE1 and its mRNA in neutrophils and eosinophils in the discrimination between asthmatics from healthy controls. Statistical analysis was performed using SPSS version 19.0.0. P <0.05 was considered significant.
RESULTS
Demographic and clinical parameters of the study subjects
We enrolled 140 healthy normal controls (NC) and 116 asthmatic patients, among which there were 50 that were assigned into the severe asthma (SA) group, while 66 were patients with non-severe asthma (NSA). There were no differences in age, BMI and sex distribution among the three groups. There was a higher rate of smokes among the asthmatic patients than in healthy controls (32.4 and 45.1 vs. 16.4%, both p<0.05). The SA group had longer asthma duration compared to the NSA group (9.56±4.38 vs. 14.37±8.56
years, p=0.014). The SA group had significantly lower baseline forced expiratory volume in 1 second (FEV1; 77.23±26.45 vs. 58.34±22.25, p=0.012) compared to the NSA group. The asthmatics had dramatically elevated serum total IgE level and serum hs-CRP levels than normal controls. In addition, the SA patients had even more increased total IgE level, serum hs-CRP levels than NSA patients (Table 1).
Table 1 Demographic and clinical parameters of the study subjects.
| Index | Controls (n=140) | NSA (n=50) | SA (n=66) |
|---|---|---|---|
| Age | 42.43±7.23 | 41.45±10.31 | 46.63±11.45 |
| Male (%) | 51 | 54 | 48 |
| BMI(kg/m2) | 24.37±3.14 | 25.52±3.67 | 25.72±4.43 |
| Smoking rate(%) | 16.4 | 32.4* | 45.1*# |
| asthma duration (years) | - | 9.56±4.38 | 14.37±8.56 # |
| Allergic history (%) | 13 | 25* | 27*# |
| Blood eosinophils( ×109/L) | 0.18±0.13 | 0.25±0.11 | 0.35±0.14# |
| Blood neutrophils ( ×109/L) | 4.11±1.04 | 4.44±1.23 | 5.67±3.14# |
| Serum Hs-CRP | 0.45±0.01 | 11.12±6.67* | 14.12±6.45 *# |
| FEV1% pred | - | 77.23±26.45 | 58.34±22.25* |
| Serum total IgE(IU/mL) | 68.16±23.52 | 199.17±45.87 | 621.45±133.59* |
BMI, Body mass index; Serum Hs-CRP, high-sensitivity C-reactive protein; FEV1% pred, forced expiratory volume in one second % of predicted value. * vs control, p<0.05; #, vs NSA, p<0.05; SA, severe asthma; NSA, Non-severe asthma.
Association between APE1 and asthma
Compared to the NC group, the serum APE1 level in the NSA and SA group were higher than that in control group. However, no significant difference was noted between the NSA and SA groups, as shown in Fig. 1A. Similarly, we found that APE1 mRNA in peripheral blood eosinophils of NSA and SA patients were significantly increased in comparison to control groups. The SA group had slightly higher eosinophil APE1 mRNA level in contrast to NSA patients, but did not reach statistical significance (Fig. 1B). As for APE1 mRNA in peripheral blood neutrophils, we observed it was significantly up-regulated in NSA and SA groups compared to controls. Noticeably, the SA patients also had a dramatically higher level of APE1 than NSA patients (Fig. 1C).

Fig. 1 A. Serum APE1 levels detected using ELISA in control, non-severe asthma (NSA) and severe asthma (SA) groups by using the ANOVA test. B. APE1 mRNA in peripheral blood eosinophils using Realtime PCR assays in control, NSA and SA groups. C. APE1 mRNA in peripheral blood neutrophils using Realtime PCR assays in control, NSA and SA groups.
We also performed the Pearson’s correlation analysis and found that APE1 mRNA levels of neutrophils of peripheral blood were significantly correlated with the other clinical indices, such as hs-CRP and Fev1%, as shown in Table 2. The serum APE1 and mRNA level in eosinophils are not correlated to the levels of hs-CRP and FEV1% pred. None of the three was correlated to total Ig E level.
Table 2 The correlation between APE1 protein or mRNA levels with the hs-CRP, Total Ig E and FEV1%.
| hs-CRP | Total Ig E | FEV1% pred | |
|---|---|---|---|
| Serum APE1 | R2=0.562, P=0.032 | R2=0.223, P=0.115 | R2=-0.307, P=0.055 |
| Eosinophils APE1 mRNA | R2=0.215, P=0.084 | R2=0.3632, P=0.064 | R2=-0.103, P=0.774 |
| Neutrophils APE1 mRNA | R2=0.775, P=0.003 | R2=0.326, P=0.076 | R2=-0.708, P=0.001 |
Serum Hs-CRP, high-sensitivity C-reactive protein; FEV1% pred, forced expiratory volume in one second % of predicted value.
Diagnostic value determined by ROC analysis
To test the diagnostic value of serum APE1 and its mRNA in eosinophils and neutrophils, we performed the Receiver Operating Characteristic (ROC) curve analysis. As shown in Fig. 2A, the peripheral blood neutrophil APE1 mRNA can distinguish asthmatic patients (NSA+SA) from healthy controls, at a cutoff value of 2.14, with the AUC of 0.893 (95% CI, 0.847-0.938; p<0.001, with 87.5% sensitivity and 84.6% specificity). We next tested if neutrophil APE1 mRNA is related to the asthma severity. As shown in Fig. 2B, the APE1 mRNA at a cutoff value of 4.24, is adequate to identify SA subject from NSA subjects, with an AUC of 0.759 (95% CI, 0.674-0.846; p<0.001, 83.4% sensitivity and 80.3% specificity). On the other hand, the serum APE1 and eosinophil mRNA level, however, did not show a diagnostic difference in separating asthmatic patients from controls, nor are they related to the asthma severity (data not shown).

Fig. 2 A. The Receiver-Operating Characteristic (ROC) analysis of APE1 mRNA in eosinophils of peripheral blood in distinguishing asthmatic patients (NSA+SA) from healthy controls, with an area under the curve value of 0.893 (95% Confidence Interval, 0.847-0.938; p < 0.001, with 87.5% sensitivity and 84.6%). B. The Receiver-Operating Characteristic (ROC) analyses of APE1 mRNA in eosinophils of peripheral blood distinguishing asthmatic patients NSA from SA groups, with an area under the curve value of 0.759 (95% Confidence Interval, 0.674-0.846; p < 0.001, 83.4% sensitivity and 80.3% specificity.
DISCUSSION
In this study, we detected the serum APE1, the peripheral blood eosinophil and neutrophil APE1 mRNA in adult asthmatic patients and healthy controls. We found although all of these markers were increased in asthmatic patients, only neutrophil APE1 mRNA has diagnostic significance in distinguishing asthmatics from controls, and also in separating severe patients from nonsevere patients. This finding establishes, for the first time the association between APE1 and asthma, and also provides an easily accessible biomarker to evaluate the asthma development and severity in a clinical setting. To the best of our knowledge, we are the first to confirm the association between APE1 and asthma.
APE1 has been increasingly viewed as a potent inflammatory regulator in a variety of inflammatory processes. In psoriatic skin, APE1 was markedly up-regulated in epidermal layers. APE1 the transcriptionally activated hypoxia-inducible factor-1α and NF-κB, two crucial transcription factors responsible for inflammation in keratinocytes. APE1 is essential for the expression of inflammatory cytokines and chemokines in HaCaT cells and primary keratinocytes 16,17. In ApoE-/- mouse model of atherosclerosis, plasma APE1 correlates with Atherosclerotic Inflammation levels and APE1/Ref-1 expression was upregulated in aortic tissues 18. In macrophages, pharmacological inhibition of APE1 with its redox function inhibitor suppresses inflammatory response in activated macrophages 19. Elevation of Serum APE1 was reported in experimental murine model for myocarditis 11.
APE1 has been used as a prediction marker of Environmental Carcinogenesis Risk, including smoking 20. Smoking can in induce a various types of DNA damage and prompts cancers. Several previous studies reported the association between genetic variability of APE1 with lung cancer. Some researchers reported that APE1 genotypes were correlated with the risk of lung cancer among smokers 21, while the others reported that APE1 polymorphisms of −656T > G located in the promoter region and D148E are closely associated with lung cancer risk under cigarette smoking exposure 22,23. Smoking has been shown to exacerbate asthma severity by aggravating inflammation 24,25. Consistent with this, in our study, we observed that the severe asthma patients have a higher smoking status than non-severe asthma and healthy controls. The smoking amount is positively associated with the asthma severity (data not shown). However, the role of APE1 in asthma has not been elucidated so far.
Our study, for the first time, confirms the diagnostic significance of APE1 mRNA in peripheral blood neutrophils. Airway inflammation in bronchial asthma is characterized by infiltration with eosinophils and neutrophils 26,27. That was the reason we detected APE1 mRNA levels from eosinophils and neutrophils. Compared to the sputum, human peripheral blood is a stable source of eosinophils and neutrophils. Our data suggests APE1 mRNA in peripheral blood neutrophils, rather than that in eosinophils, can be used as a biomarker. Since we enrolled adult asthmatics, we cannot exclude the role of eosinophils APE1 m RNA in asthmatic children. To our surprise, our data did not reveal the clinical significance of serum APE1 for asthma diagnosis and classify its severity. In conclusion, our study discovered an easily accessible biomarker for asthma evaluation. Of course, further validation of our finding with a larger scale of sample size is needed.














