<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>0798-2259</journal-id>
<journal-title><![CDATA[Revista Científica]]></journal-title>
<abbrev-journal-title><![CDATA[Rev. Cient. (Maracaibo)]]></abbrev-journal-title>
<issn>0798-2259</issn>
<publisher>
<publisher-name><![CDATA[UNIVERSIDAD DEL ZULIA]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S0798-22592006000600008</article-id>
<title-group>
<article-title xml:lang="es"><![CDATA[Identificación diferencial de aislados clínicos de mycobacterium tuberculosis y mycobacterium bovis por un ensayo de rcp múltiple]]></article-title>
<article-title xml:lang="en"><![CDATA[Differential Identification of Mycobacterium tuberculosis and Mycobacterium bovis Clinical Isolates by Multiplex PCR Assay]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Arráiz]]></surname>
<given-names><![CDATA[Nailet]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Romay]]></surname>
<given-names><![CDATA[Zolay]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Faría]]></surname>
<given-names><![CDATA[Nelba]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Mujica]]></surname>
<given-names><![CDATA[Dámaso]]></given-names>
</name>
<xref ref-type="aff" rid="A03"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Universidad del Zulia Facultad de Medicina Centro de Investigaciones Endocrino-Metabólicas Dr. Félix Gómez]]></institution>
<addr-line><![CDATA[Maracaibo ]]></addr-line>
<country>Venezuela</country>
</aff>
<aff id="A02">
<institution><![CDATA[,Hospital Universitario de Maracaibo Laboratorio de tuberculosis ]]></institution>
<addr-line><![CDATA[ ]]></addr-line>
</aff>
<aff id="A03">
<institution><![CDATA[,Universidad del Zulia Facultad de Ciencias Veterinarias ]]></institution>
<addr-line><![CDATA[ ]]></addr-line>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>12</month>
<year>2006</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>12</month>
<year>2006</year>
</pub-date>
<volume>16</volume>
<numero>6</numero>
<fpage>622</fpage>
<lpage>628</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S0798-22592006000600008&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_abstract&amp;pid=S0798-22592006000600008&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_pdf&amp;pid=S0798-22592006000600008&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="es"><p><![CDATA[Mycobacterium tuberculosis es el agente causal de tuberculosis en humanos, sin embargo, la transmisión zoonótica de Mycobacterium bovis de animales a humanos, principalmente a individuos inmunocomprometidos, es de gran impacto en salud pública. La necesidad de diseñar métodos rápidos y precisos que permitan diferenciar entre M. tuberculosis y M. bovis ha conducido al desarrollo de estrategias de identificación genotípica. El objetivo de este estudio fue evaluar el poder discriminatorio de un ensayo de reacción en cadena de la polimerasa en formato múltiple para diferenciar entre aislados clínicos de M. tuberculosis y M. bovis. Se estandarizaron condiciones para amplificación simultánea con oligonucleótidos dirigidos a secuencias de genes Rv0577 y Rv1510. Rv0577 es específico de micobacterias del Complejo M. tuberculosis y Rv1510 se localiza en regiones polimórficas (RD4) del genoma de cepas del complejo M. tuberculosis, ausentes en M. bovis y M. bovis BCG, permitiendo diferenciar entre estas dos especies del complejo M. tuberculosis. Para evaluar la especificidad del ensayo se analizaron 46 aislados clínicos. El amplicón correspondiente a Rv0577 se detectó en todos los aislados clínicos del complejo M. tuberculosis, mientras que el producto de 1033 pb Rv1510 (RD4), se observó exclusivamente en M. tuberculosis, pero no en M. bovis, ni en M. bovis BCG, demostrando la especificidad de este ensayo de RCP para identificar micobacterias del complejo M.tuberculosis y diferenciar entre M. tuberculosis y M. bovis en una única reacción de amplificación. Dada la especificidad del ensayo, éste puede ser aplicado para la identificación y diferenciación de micobacterias del complejo M. tuberculosis en muestras clínicas, para hacer control de calidad de productos derivados de animales con sospechas de infección y desarrollar estudios a gran escala de transmisión zoonótica de M. bovis en poblaciones vulnerables]]></p></abstract>
<abstract abstract-type="short" xml:lang="en"><p><![CDATA[Mycobacterium tuberculosis is the causal agent of tuberculosis in humans, however, the zoonotic transmission of Mycobacterium bovis from animals to humans, mainly immunocompromised individuals, is of great impact in public health. The necessity to design rapid and precise methods to differentiate between M. tuberculosis and M. bovis has lead to the development of strategies of genotypic identification. The aim of this study was to evaluate the discriminatory power of a multiplex PCR assay to differentiate between M. tuberculosis and M. bovis clinical isolates. Conditions for simultaneous amplification with oligonucleótidos targeted Rv0577 and Rv1510 genes sequences were standardized. Rv0577 is specific of M. tuberculosis complex mycobacteria and Rv1510 is located in polymorphic regions (RD4) of the mycobacterial genome of M. tuberculosis complex, but is absent in M. bovis and M. bovis BCG, allowing to differentiate between M. tuberculosis complex strains. To evaluate the specificity of the PCR assay, 46 clinical isolates were analyzed. The amplicon from Rv0577 gene was detected in all of the clinical isolates from M. tuberculosis complex, whereas the 1033 pb product from Rv1510 (RD4), was exclusively observed in M. tuberculosis and was absent in M. bovis and M. bovis BCG, showing the specificity of this PCR assay to identify mycobacteria of the M. tuberculosis complex and to differentiate between M. tuberculosis and M. bovis in a single-step assay. This multiplex PCR assay can be applied to the identification and differentiation of mycobacteria of M. tuberculosis complex in clinical samples, to the quality control of products derived from animals with infection suspicions and to develop studies on great scale of zoonotic transmission of M. bovis in susceptible populations]]></p></abstract>
<kwd-group>
<kwd lng="es"><![CDATA[M. tuberculosis]]></kwd>
<kwd lng="es"><![CDATA[M. bovis]]></kwd>
<kwd lng="es"><![CDATA[RCP múltiple]]></kwd>
<kwd lng="es"><![CDATA[Rv1510, RD4, Rv0577]]></kwd>
<kwd lng="en"><![CDATA[M. tuberculosis]]></kwd>
<kwd lng="en"><![CDATA[M. bovis]]></kwd>
<kwd lng="en"><![CDATA[multiplex PCR]]></kwd>
<kwd lng="en"><![CDATA[Rv1510, RD4, Rv0577]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  <BASEFONT SIZE="3">     <p align="center" style="word-spacing: 0; line-height: 100%"><b><span style="color: black"><font face="Verdana" size="3">Identificación diferencial de aislados clínicos de <i>mycobacterium tuberculosis y mycobacterium bovis </i>por un ensayo de rcp múltiple.</font></span></b></p>      <P align="CENTER" style="word-spacing: 0; line-height: 100%"><font size="3"><B><FONT COLOR="000000" face="Verdana"> Differential Identification of </FONT> </B><FONT COLOR="000000" face="Verdana"> <I><B>Mycobacterium tuberculosis </B></I><B>and </B><I><B>Mycobacterium  bovis</B></I><B> Clinical Isolates by Multiplex PCR Assay.</B> </FONT></font></P>     <P align="CENTER" style="word-spacing: 0; line-height: 100%"><font size="2"><B><FONT COLOR="000000" face="Verdana"> Nailet Arráiz</FONT></B><FONT COLOR="000000" face="Verdana"><SUP><B>1</B></SUP><B>*, Zolay Romay</B><SUP><B>2</B></SUP><B>, Nelba Faría</B><SUP><B>2</B></SUP><B> y Dámaso Mujica</B><SUP><B>3</B></SUP></FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><SUP><FONT COLOR="000000" face="Verdana"> 1</FONT></SUP><FONT COLOR="000000" face="Verdana"><sup> </sup>Centro de Investigaciones Endocrino-Metabólicas “Dr. Félix Gómez”, Sección  de Biología Molecular, Facultad de Medicina, Universidad del Zulia. Maracaibo,  Venezuela. E-mail: narraiz@cantv.net.</FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><SUP><FONT COLOR="000000" face="Verdana"> 2</FONT></SUP><FONT COLOR="000000" face="Verdana"><sup> </sup>Coordinación del Programa Regional  de Control de Tuberculosis, Laboratorio de tuberculosis, Servicio Autónomo Hospital Universitario de Maracaibo.</FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" face="Verdana"><SUP>3 </SUP></FONT><font face="Verdana" size="2">Facultad de Ciencias Veterinarias,  Universidad del Zulia.</font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> RESUMEN </FONT></B></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"> <I><FONT COLOR="000000" face="Verdana"> Mycobacterium </FONT></I><FONT COLOR="000000" face="Verdana"> <I>  tuberculosis </I>es el agente causal de tuberculosis en humanos,  sin embargo, la transmisión zoonótica de <I>Mycobacterium bovis </I>de animales  a humanos, principalmente a individuos inmunocomprometidos, es de gran  impacto en salud pública. La necesidad de diseñar métodos rápidos y precisos  que permitan diferenciar entre <I>M. tuberculosis</I> y <I>M. bovis</I> ha conducido  al desarrollo de estrategias de identificación genotípica. El objetivo  de este estudio fue evaluar el poder discriminatorio de un ensayo de reacción  en cadena de la polimerasa en formato múltiple para diferenciar entre aislados  clínicos de <I>M. tuberculosis</I> y <I>M. bovis. </I>Se estandarizaron condiciones para  amplificación simultánea con oligonucleótidos dirigidos a secuencias de  genes Rv0577 y Rv1510. Rv0577 es específico de micobacterias del Complejo  <I>M. tuberculosis</I> y Rv1510 se localiza en regiones polimórficas (RD4) del  genoma de cepas del complejo <I>M. tuberculosis</I>, ausentes en <I>M. bovis</I> y <I>M.  bovis</I> BCG, permitiendo diferenciar entre estas dos especies del complejo  <I>M. tuberculosis</I>. Para evaluar la especificidad del ensayo se analizaron  46 aislados clínicos. El amplicón correspondiente a Rv0577 se detectó en  todos los aislados clínicos del complejo <I>M. tuberculosis</I>, mientras que  el producto de 1033 pb Rv1510 (RD4), se observó exclusivamente en <I>M. tuberculosis</I>,  pero no en <I>M. bovis</I>, ni en <I>M. bovis</I> BCG, demostrando la especificidad de  este ensayo de RCP para identificar micobacterias del complejo <I>M.tuberculosis</I>  y diferenciar entre <I>M. tuberculosis</I> y <I>M. bovis</I> en una única reacción de  amplificación. Dada la especificidad del ensayo, éste puede ser aplicado  para la identificación y diferenciación de micobacterias del complejo <I>M.  tuberculosis</I> en muestras clínicas, para hacer control de calidad de productos  derivados de animales con sospechas de infección y desarrollar estudios  a gran escala de transmisión zoonótica de <I>M. bovis</I> en poblaciones vulnerables. </FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><B><FONT COLOR="000000"> Palabras clave: </FONT></B><i>M. tuberculosis, M. bovis</i>, RCP múltiple, Rv1510, RD4, Rv0577.</font></P>      ]]></body>
<body><![CDATA[<P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> ABSTRACT </FONT></B></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"> <I><FONT COLOR="000000"> Mycobacterium tuberculosis </FONT></I> <FONT COLOR="000000">  is the causal agent of tuberculosis in humans,  however, the zoonotic transmission of <I>Mycobacterium bovis</I> from animals  to humans, mainly immunocompromised individuals, is of great impact in  public health. The necessity to design rapid and precise methods to differentiate  between <I>M. tuberculosis </I>and <I>M. bovis</I> has lead to the development of strategies  of genotypic identification. The aim of this study was to evaluate the  discriminatory power of a multiplex PCR assay to differentiate between <I>M. tuberculosis</I> and <I>M. bovis</I> clinical isolates. Conditions for simultaneous  amplification with oligonucleótidos targeted Rv0577 and Rv1510 genes sequences  were standardized. Rv0577 is specific of <I>M. tuberculosis</I> complex mycobacteria  and Rv1510 is located in polymorphic regions (RD4) of the mycobacterial  genome of <I>M. tuberculosis</I> complex, but is absent in <I>M. bovis</I> and <I>M. bovis</I>  BCG, allowing to differentiate between <I>M. tuberculosis</I> complex strains. To evaluate the specificity of the PCR assay, 46 clinical isolates were  analyzed. The amplicon from Rv0577 gene was detected in all of the clinical  isolates from <I>M. tuberculosis</I> complex, whereas the 1033 pb product from  Rv1510 (RD4), was exclusively observed in <I>M. tuberculosis</I> and was absent  in <I>M. bovis </I>and <I>M. bovis</I> BCG, showing the specificity of this PCR assay  to identify mycobacteria of the <I>M. tuberculosis</I> complex and to differentiate  between <I>M. tuberculosis</I> and <I>M. bovis</I> in a single-step assay. This multiplex PCR assay can be applied to the identification and differentiation of mycobacteria  of <I>M. tuberculosis</I> complex in clinical samples, to the quality control  of products derived from animals with infection suspicions and to develop  studies on great scale of zoonotic transmission of <I>M. bovis</I> in susceptible  populations.</FONT></font></P>    <P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><B><FONT COLOR="000000"> Key words: </FONT></B><i>M. tuberculosis, M. bovis</i>, multiplex PCR, Rv1510, RD4, Rv0577.</font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><b><font COLOR="000000" face="Verdana">Recibido: </font></b><font COLOR="000000" face="Verdana">08 / 06 / 2005.&nbsp; <b>Aceptado: </b>27 / 07 / 2006.</font></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> INTRODUCCIÓN </FONT></B></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> El complejo <I>Mycobacterium tuberculosis</I> comprende micobacterias de crecimiento  lento causantes de tuberculosis en animales y humanos, difíciles de diferenciar  por métodos bacteriológicos convencionales. El grupo incluye <I>M. tuberculosis</I>  causante de tuberculosis en humanos; <I>M. bovis</I> que infecta principalmente  el ganado bovino, pero también causa tuberculosis en humanos; <I>M. bovis </I>BCG, el derivado atenuado de la cepa de <I>M. bovis</I> comúnmente utilizado como  vacuna de protección contra <I>M. tuberculosis</I>; <I>M. africanum</I>, especie causante  de tuberculosis humana en el continente africano; <I>M. microti</I>, la cual es  patogénica en roedores y <I>M. canetti</I>, una subespecie de <I>M. tuberculosis</I>  reportada en tuberculosis humana<I> </I>[13,15, 29, 32]. A pesar de la definición  de un rango relativo de hospedador, se conoce que ocurre transmisión zoonótica  de todas estas especies de animales a humanos [1, 13, 15, 30], de hecho,  la transmisión zoonótica de <I>M. bovis</I> de animales a humanos por el consumo  de leche no pasteurizada y otros productos de animales infectados, tiene  gran impacto en salud pública [3, 10, 11]. También se han reportado infecciones  por <I>M. bovis</I> BCG en niños vacunados y pacientes con algún compromiso del  sistema inmune e infectados por el virus HIV [4, 14, 25]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> La infección por <I>M. bovis</I> tiene gran importancia desde el punto de vista  terapéutico, debido a que su patrón de susceptibilidad a antibióticos difiere  al de <I>M. tuberculosis</I>, por ejemplo, la mayoría de las cepas de <I>M. bovis</I>  tienen resistencia natural a pirazinamida, una de las drogas de primera  línea utilizadas en el tratamiento de la tuberculosis [19, 26], de manera  que la identificación de aislados clínicos del complejo <I>M. tuberculosis</I>,  particularmente la diferenciación entre especies <I>M. tuberculosis</I> y <I>M. bovis</I>  es un aspecto clave para el tratamiento adecuado del paciente y para brindar  información epidemiológica a las Coordinaciones de los Programas de Control  de Tuberculosis. A pesar de la limitada información epidemiológica de la  incidencia de la tuberculosis por <I>M. bovis</I> en el mundo, diversos reportes  han señalado que la infección por <I>M. bovis </I>tiene gran impacto en salud  pública en países de África, América Latina y el Caribe [1, 3, 10, 11,  36]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> La inexistencia de métodos rápidos y precisos que permitan diferenciar  entre <I>M. tuberculosis</I> y <I>M. bovis</I> ha conducido a diversos grupos de investigación  a emplear la técnica de reacción en cadena de la polimerasa (RCP) para  detectar diferencias genotípicas entre estas especies. Uno de los ensayos  propuestos inicialmente, se diseñó basándose en el hecho de que <I>M. tuberculosis</I>  contiene en su genoma mayor número de copias del elemento de inserción  <I>IS6110</I> que <I>M. bovis</I>, sin embargo, estudios posteriores demostraron que  algunas cepas de <I>M. bovis</I> también tenían alto número de copias de IS6110  y a su vez, algunas cepas de <I>M. tuberculosis</I> exhibían bajo número de copias  de este elemento de inserción [28]. Otro intento resultó del estudio del  gen <I>mtp-40</I>, el cual presumiblemente estaba presente en <I>M. tuberculosis</I>  y ausente en <I>M. bovis</I> [21], demostrándose luego que el gen estaba ausente  en varias cepas de <I>M. tuberculosis</I> y presente en varias cepas de <I>M. bovis  </I>[33]. En estudios posteriores se han incorporado otros marcadores genéticos  para diferenciar entre <I>M. tuberculosis</I> y <I>M. bovis</I> [20, 23, 24, 35], destacándose  el diseño de ensayos de RCP que se basan en la caracterización de polimorfismos  de ADN que dependen de la presencia o no de regiones espaciadoras localizadas  entre dos secuencias [6, 22, 27]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Diversos estudios comparativos utilizando estrategias de hibridación genética  han puesto en evidencia estas regiones de diferenciación (RD), que representan  pérdida de material genético en <I>M. bovis</I> en relación con <I>M. tuberculosis</I>  H37Rv [7, 9, 12], de hecho, se ha propuesto que esto puede estar relacionado  con el proceso de atenuación de <I>M. bovis</I> BCG (Bacilo Calmette-Guerin) [7].  Estas regiones de diferencia incluyen largas secuencias polimórficas (LSP)  que parecen haberse acumulado secuencialmente y están diferencialmente  distribuidas entre varios grupos de micobacterias del complejo tuberculosis  [9, 12, 18]. Estas LSP se han utilizado recientemente para diferenciar  entre varias cepas del complejo <I>M. tuberculosis</I> y establecer relaciones  filogenéticas [16, 17, 22]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Dada la distribución diferencial de estas LSP en cepas del complejo <I>Mycobacterium  tuberculosis</I>, en el presente estudio se evaluaron oligonucleótidos basados  en secuencias RD4 [16] para diferenciar entre aislados clínicos de<I> M. tuberculosis</I>  y <I>M. bovis</I>. Posteriormente estos oligonucleótidos se utilizaron en una  RCP en formato múltiple para amplificar simultáneamente con otros oligonucleótidos  específicos del género <I>Mycobacterium</I> y para el Complejo <I>Mycobacterium tuberculosis</I>. </FONT></P>     ]]></body>
<body><![CDATA[<p align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> MATERIALES Y MÉTODOS </FONT></B>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><B><FONT COLOR="000000" face="Verdana"> Cepas de m</FONT></B><FONT COLOR="000000" face="Verdana"><B>icobacterias</B> </FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Se evaluaron 46 cepas micobacterianas aisladas de muestras de esputo provenientes  de pacientes con clínica de tuberculosis, incluyendo 36 aislados clínicos  de <I>M. tuberculosis</I>, 8 de <I>M. bovis</I> y 2 de <I>M. bovis </I>BCG. Los aislados clínicos  fueron caracterizados por análisis fenotípico y características bioquímicas  en el laboratorio de Diagnóstico de Tuberculosis con sede en el Servicio  Autónomo del Hospital Universitario de Maracaibo (SAHUM), laboratorio de  referencia que procesa muestras provenientes de todos los municipios del  estado Zulia. Este laboratorio está adscrito al Programa Regional de Control  de Tuberculosis. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> Oligonucleótidos utilizados </FONT></B> </P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Para la identificación de micobacterias <I>M. tuberculosis</I>, <I>M. bovis</I> y <I>M.  bovis</I> BCG, pertenecientes al complejo <I>M. tuberculosis</I>, se utilizaron tres  pares de secuencias que se indican en la <a href="#TABLA I"> TABLA I</a>. Un par género-específico  dirigido a la secuencia del gen ribosomal 16S (rDNA 16S) que permite detectar  cualquier miembro del género <I>Mycobacterium</I>. Otro par, dirigido a la secuencia  del marco de lectura identificado como Rv0577, se utilizó para identificar  cepas del complejo <I>M. tuberculosis</I> y un tercer par de oligonucleótidos  correspondiente a la secuencia del gen Rv1510, localizado en el locus RD4,  presente en todas en las cepas del complejo <I>M. tuberculosis</I>, excepto en  <I>M. bovis</I> [9, 12, 16], se utilizó para diferenciar entre <I>M. tuberculosis</I>  y <I>M. bovis</I>. La identidad de estos oligonucleótidos fue confirmada por alineamiento  de sus secuencias utilizando el programa Blastn y las Bases de Datos European  Molecular Biology Laboratory (EMBL) del Centro Nacional de Información  Biotecnológica de EUA (NCBI) y del Centro de Sanger, de los Proyectos de  Secuenciación de los genomas de <I>M. tuberculosis</I> H37Rv. </FONT></P>      <p ALIGN="CENTER"><font face="Verdana" size="2" color="000000"><b><a name="TABLA I">TABLA I</a>. </b>OLIGONUCLEÓTIDOS UTILILIZADOS EN ESTE ESTUDIO / PRIMERS USED IN THIS STUDY</font></p>     <div align="center">       <center>   <table width="580" border="1">     <tr>       <td VALIGN="TOP" width="83">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Nombre         del oligoNT</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Secuencia         de nucleótidos</font></p>       </td>       <td VALIGN="TOP" width="150">             ]]></body>
<body><![CDATA[<p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Gen</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">(Región         amplificada)</font></p>       </td>       <td VALIGN="TOP" width="66">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Tamaño         del producto</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">de RCP</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv0577F</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         ATGCCCAAGAGAAGCGAATACAGGCAA 3’</font></p>       </td>       <td VALIGN="TOP" ROWSPAN="2" width="150">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Marco de         lectura de función desconocida</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Complejo <i>M.         tuberculosis</i></font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">(671949-671164)</font></p>       </td>       <td ROWSPAN="2" width="66">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">786pb</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             ]]></body>
<body><![CDATA[<p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv0577R</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         CTATTGCTGCGGTGCGGGCTTCAA 3’</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv1510F</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         GTGCGCTCCACCCAAATAGTTGC 3’</font></p>       </td>       <td VALIGN="TOP" ROWSPAN="2" width="150">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Gen         ubicado en región RD4</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Ausente         en <i>M. bovis</i></font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">(1702610-1701578)</font></p>       </td>       <td ROWSPAN="2" width="66">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">1033pb</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv1510R</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         TGTCGACCTGGGGCACAAATCAGT C 3’</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             ]]></body>
<body><![CDATA[<p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv16SrDNAF</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         ACGGTGGGTACTAGGTGTGGGTTTC 3’</font></p>       </td>       <td VALIGN="TOP" ROWSPAN="2" width="150">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Gen de         rDNA 16S</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">Género         específico</font></p>             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">(1472650-1473192)</font></p>       </td>       <td ROWSPAN="2" width="66">             <p ALIGN="CENTER"><font COLOR="000000" SIZE="2" face="Verdana">543pb</font></p>       </td>     </tr>     <tr>       <td VALIGN="TOP" width="83">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">Rv16SrDNAR</font></p>       </td>       <td VALIGN="TOP" width="266">             <p ALIGN="LEFT"><font COLOR="000000" SIZE="2" face="Verdana">5’         TCTGCGATTACTAGCGACTCCGACTTCA 3’</font></p>       </td>     </tr>   </table>   </center> </div>     <p ALIGN="LEFT"><font color="000000" face="Verdana" size="2">Los oligonucleótidos fueron seleccionados de referencia 16 y sintetizados por Maxim Biotech, INC.</font></p>      <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> Extracción y purificación de ADN genómico de colonias de micobacterias </FONT></B> </P>      ]]></body>
<body><![CDATA[<P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> La extracción de ADN de colonias micobacterianas se llevó a cabo utilizando  un procedimiento de lisis enzimática convencional [2] con algunas modificaciones.  Se tomó una asada de una colonia micobacteriana, se transfirió a un tubo,  se inactivó con calor a 90°C por 1 hora y se sometió a tratamiento con  etanol a una concentración final de 70% por 6 horas para provocar muerte  celular [34]. Esta suspensión se centrifugó a 14000 rpm por 5 minutos,  se descartó el sobrenadante y el sedimento se resuspendió en 500 µL de  Buffer TE (10 mM Tris-HCl, pH 8, 1mM EDTA, pH 8). Se agregaron 100 µL de  lisozima 10mg/mL y se incubó a 37°C por 1 hora. Se agregaron 70 µL de SDS  10% y 10 µL de proteinasa K 10&nbsp;mg/mL, se incubó a 65°C por 1 hora. Se hizo  extracción con 500 µL de cloroformo y se centrifugó a 14.000 rpm por 5  minutos. La fase acuosa se transfirió a otro tubo y el ADN se precipitó  con 500 µL de isopropanol. El ADN se resuspendió en 40&nbsp;µL de buffer TE.  Se utilizó 3 µL de la muestra para ensayos de amplificación. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><B><FONT COLOR="000000" face="Verdana"> Ensayos de amplificación por </FONT> </B><FONT COLOR="000000" face="Verdana"> <B>RCP</B> </FONT></font></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Para las reacciones de amplificación, se preparó la mezcla de reacción  para un volumen final de 50 µL, consistiendo en 5 µL de buffer Taq DNA  polimerasa (Promega), 1,5 mM MgCl<SUB>2</SUB>, 200µM cada desoxirribonucleótido (dATP,  dCTP, dGTP y dTTP), 1 µL de cada oligonucleótido 10 µM (10 pmoles cada  oligonucleótido). Se utilizó 0,25 µL de Taq DNA polimerasa 5U/µL para cada  reacción (PROMEGA). Se ensayaron temperaturas de alineamiento en el rango  de 52°C hasta 60°C para reacciones de amplificación con pares de oligonucleótidos  individuales. Finalmente se seleccionó 58°C como temperatura de alineamiento  óptima para la amplificación con todos los pares de oligonucleótidos ensayados.  El programa de amplificación consistió en un paso de desnaturalización  inicial de 5 minutos a 94°C y 30 ciclos de amplificación de 1 minuto a  94°C, 1 minuto a 58°C, 1 minuto a 72°C y un paso final de extensión a 72°C  por 5 minutos. Las reacciones se llevaron a cabo en termociclador MJ Research  PTC-100. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Los productos de RCP se analizaron en geles de agarosa al 1%. La corrida  electroforética se llevó a cabo a 40v/cm por 1-3 horas. Los geles fueron  teñidos y fotografiados con sistema de fotodocumentación DigiDoc UVP. Se  utilizó marcador de peso molecular PCR markers de PROMEGA (1000, 750, 500,  300, 150 y 50 pb). </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Como control negativo de amplificación se utilizó ADN genómico de bacterias  Gram negativas (<I>Escherichia coli</I>) y Gram positivas (<I>Staphylococcus aureus</I>),  procesadas en paralelo con las muestras de micobacterias, permitiendo monitorear  especificidad y riesgos de contaminación. </FONT></P>    <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> RESULTADOS Y DISCUSIÓN </FONT></B></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Se analizó un total de 46 aislados clínicos de micobacterias, incluyendo  36 cepas de <I>M. tuberculosis</I>, 8 de <I>M. bovis</I> y 2 de <I>M. bovis </I>BCG. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> En una primera fase del análisis, el ADN extraído de todos los aislados  clínicos se sometieron a una primera ronda de amplificación utilizando  un ensayo de RCP duplex previamente estandarizado en el laboratorio que  permite identificar cepas del complejo <I>M. tuberculosis</I>. El ensayo incluye  oligonucleótidos género-específicos basados en la secuencia del gen ribosomal  rDNA 16S que amplifican un segmento de 543 pb en el genoma de cualquier  micobacteria. El otro par de oligonucleótidos está dirigido al marco de  lectura Rv0577, un gen que está presente exclusivamente en el genoma del  complejo <I>M. tuberculosis</I> y generan un fragmento de 786 pb (<a href="#TABLA I">TABLA I</a>). </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Consistente con la especificidad de secuencias, al utilizar estos oligonucleótidos,  se generaron dos bandas de tamaños esperados en todos los aislados clínicos  analizados (<a href="#FIG1">FIGS. 1</a> y <a href="#FIG2">2</a>), confirmando que son micobacterias (fragmento  de 543 pb) y que todas pertenecen al complejo <I>M. tuberculosis</I> (fragmento  de 786 pb). En el caso de micobacterias no pertenecientes al complejo <I>M.  tuberculosis</I>, solo amplifica la secuencia rDNA 16S (543 pb), identificación  que es realizada de rutina en el laboratorio, pero no se aislaron micobacterias  no tuberculosas en el presente estudio. </FONT></P>      <P align="center" style="word-spacing: 0; line-height: 100%"><a name="FIG1"><img border="0" src="/img/fbpe/rc/v16n6/art08fig1.jpg" width="556" height="468"></a></P>      
]]></body>
<body><![CDATA[<P align="center" style="word-spacing: 0; line-height: 100%"><a name="FIG2"><img border="0" src="/img/fbpe/rc/v16n6/art08fig2.jpg" width="553" height="465"></a></P>      
<P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> El mismo patrón de amplificación se observó en todas las cepas de crecimiento  lento aisladas de pacientes con clínica de tuberculosis. Es importante  destacar, que aun cuando se toman en consideración datos epidemiológicos,  la decisión terapéutica en casos de tuberculosis pulmonar, siempre se inclina  al tratamiento contra <I>M. tuberculosis</I>. Los antibióticos de primera línea  contra <I>M. tuberculosis</I> incluyen: isoniazida, rifampicina y pirazinamida,  sin embargo <I>M. bovis</I> tiene un patrón de susceptibilidad diferente y exhibe resistencia natural a pirazinamida [19, 26], por lo cual es de gran utilidad  aplicar estrategias de identificación rápidas que garanticen un tratamiento  oportuno y acertado del paciente.</FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> La transmisión zoonótica de <I>M. bovis</I> a humanos se ha atribuido al contacto  directo con animales infectados o el consumo de leche proveniente de estos  animales [3, 10, 11, 36]. Adicionalmente en los pacientes infectados por  HIV, se ha reportado coinfección con<I> M. bovis</I> BCG [14] y con <I>M. bovis</I> multirresistente  a drogas [8, 14, 25]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Debido al lento crecimiento de estas micobacterias y a algunas limitaciones  para diferenciarlas por técnicas convencionales, se han evaluado diversas  técnicas de identificación basadas en características genotípicas [20-24,  28, 33, 35], sin embargo, también se han encontrado obstáculos debido a  que los miembros del complejo <I>M. tuberculosis</I>, a pesar de variar en su  potencial patogénico, localización geográfica y rango de hospedador exhiben  un alto grado de conservación de secuencias en sus genomas y esta identidad  de secuencia es principalmente notable entre <I>M. tuberculosis</I> y <I>M. bovis</I>  [9]. Algunos ensayos para el diagnóstico de tuberculosis están disponibles  comercialmente, sin embargo presentan algunas desventajas para propósitos  de rutina como un mayor costo, técnicas adicionales de hibridación y lo  más importante es que no distinguen entre <I>M. tuberculosis</I> y <I>M. bovis</I> [5,  31]. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Dado el carácter polimórfico de las secuencias de las regiones RD entre  varios miembros del complejo <I>M. tuberculosis</I> señaladas por diversos autores  [7, 9, 12, 16-18, 22], en este trabajo se seleccionaron oligonucleótidos  dirigidos al gen Rv1510 localizado internamente en la región de diferenciación  RD4 del genoma de miembros del complejo <I>M. tuberculosis</I> [16]. Este locus  RD4 está ausente en <I>M. bovis</I> [7, 12, 22], por lo cual se sintetizaron oligonucleótidos  dirigidos a Rv1510 y se incorporaron en un formato de RCP múltiple para  detectar micobacterias del complejo <I>M. tuberculosis</I> y simultáneamente diferenciar  entre <I>M. tuberculosis y M. bovis</I>. Para validar el ensayo, las mismas muestras  de ADN de los aislados clínicos que resultaron positivas para miembros  del complejo <I>M. tuberculosis</I> en el análisis anterior (<a href="#FIG1">FIG. 1</a>), se analizaron  con el ensayo de RCP múltiple, incluyendo los oligonucleótidos para genes  rDNA 16S, Rv0577 y Rv1510. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Confirmando lo reportado en la literatura, en la <a href="#FIG2"> FIG. 2</a> puede observarse  un amplicón de 1.033 pb correspondiente al gen Rv1510, exclusivamente en  <I>M. tuberculosis</I>, pero no en <I>M. bovis</I>, ni en <I>M. bovis</I> BCG. La ausencia del  fragmento de 1.033 pb revela la identidad de cepas de <I>M. bovis</I> y <I>M. bovis</I>  BCG. Igualmente, la presencia del amplicón de 786 pb en todos los aislados  clínicos (<a href="#FIG1">FIGS. 1</a> y <a href="#FIG2">2</a>), demuestra la utilidad del par de oligonucleótidos  de Rv0577 para detectar cepas del complejo <I>M. tuberculosis</I>. Este fragmento  de 786 pb tanto en las reacciones de RCP duplex, como múltiple, fue consistentemente  más débil que las otras bandas a pesar de numerosos intentos de estandarización,  incluyendo varias temperaturas de alineamiento e incremento en la concentración  de oligonucleótidos. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> La identificación diferencial entre <I>M. tuberculosis</I> y<I> M. bovis </I>se correlacionó  100% con los resultados obtenidos por técnicas fenotípicas y análisis bioquímicos  convencionales, sin embargo, se requieren pruebas genotípicas adicionales  para lograr la identificación entre <I>M. bovis</I> y <I>M. bovis</I> BCG. En estos casos,  se debe tomar en cuenta aspectos epidemiológicos, debido a que el aislamiento  de <I>M. bovis</I> fue predominantemente asociado a personas que laboran o viven  en regiones de intensa actividad agropecuaria. Una de las cepas de <I>M. bovis</I>  BCG fue aislada recientemente de una niña que desarrolló infección posterior  a la aplicación del protocolo de inmunización, lo cual condujo a investigar  y determinar que padecía un estado de inmunosupresión. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> De acuerdo a los resultados obtenidos, la aplicación de estos ensayos en  formatos duplex o múltiple representan una estrategia de diagnóstico rápida  y específica para la detección de micobacterias y diferenciación entre  especies <I>M. tuberculosis </I>y <I>M. bovis</I>, brindando beneficios invalorables  al paciente al orientar un protocolo terapéutico eficaz y oportuno. </FONT></P>     <p align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana"> CONCLUSIONES </FONT></B>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> En este trabajo se demostró la especificidad de un ensayo de RCP en formato  múltiple para identificar micobacterias del complejo <I>M. tuberculosis</I> y  discriminar entre especies <I>M. tuberculosis</I> y <I>M. bovis</I> (incluyendo <I>M. bovis</I>  BCG) en una única reacción de amplificación. </FONT></P>      ]]></body>
<body><![CDATA[<P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Los resultados de este estudio permiten proponer la aplicación de este  protocolo de RCP para la identificación diferencial de cepas de <I>M. tuberculosis</I>,  <I>M. bovis</I> y <I>M. bovis </I>BCG en muestras clínicas y también para ser incorporado  en esquemas de control de calidad de productos lácteos y cárnicos de animales  con sospechas de infección y estudios a gran escala de transmisión zoonótica  de <I>M. bovis</I> en poblaciones vulnerables.</FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><B><FONT COLOR="000000" size="2" face="Verdana">AGRADECIMIENTO </FONT></B> </P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> Al Consejo de Desarrollo Científico y Humanístico de la Universidad del  Zulia por el cofinanciamiento de esta investigación (Programa CONDES N°  CC-0241-02). </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><FONT COLOR="000000" size="2" face="Verdana"> A la Oficina de Planificación del Sector Universitario (OPSU) por su contribución  en el fortalecimiento y equipamiento del laboratorio de Biología Molecular  del Centro de Investigaciones Endocrino-Metabólicas “Dr. Félix Gómez” de  la Facultad de Medicina de la Universidad del Zulia. </FONT></P>      <P align="justify" style="word-spacing: 0; line-height: 100%"><font size="2"><B><FONT COLOR="000000" face="Verdana"> REFERENCIAS </FONT></B><FONT COLOR="000000" face="Verdana"> <B> BIBLIOGRÁFICAS</B> </FONT></font></P>      <!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">1. ABALOS, P.; RETAMAL, P.<B> </B>Tuberculosis: a re-emerging zoonosis?. <B>Rev. Sci.  Tech. </B>23: 583-594. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567682&pid=S0798-2259200600060000800001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">2. AUSUBEL, F.M. <B>Short Protocols in Molecular Biology.</B> 2da Ed. John Wiley   Sons, Inc. New York, USA. 680 pp. 1992. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567683&pid=S0798-2259200600060000800002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">3. AYELE, W.Y.; NEILL, S.D.; ZINSSTAG, J.; WEISS, M.G.; PAVLIK, I. Bovine  tuberculosis: an old disease but a new threat to Africa. <B>Int. J. Tuberc.  Lung Dis.</B> 8: 924-937. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567684&pid=S0798-2259200600060000800003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">4. BAROUNI, A.S.; AUGUSTO, C.; QUEIROZ, M.V.; LOPES, M.T.; ZANINI, M.S.; SALAS,  C.E. BCG lymphadenopathy detected in a BCG-vaccinated infant. <B>Braz J. Med.  Biol. Res</B>. 37: 697-700. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567685&pid=S0798-2259200600060000800004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">5. BEAVIS, K.G.; LICHTY, M.B.; JUNGKIND, D.J.; GIGER, O. Evaluation of Amplicor  PCR for direct detection of <I>M: tuberculosis</I> from sputum specimens. <B>J. Clin  Microbiol. </B>33: 2582-2585. 1995. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567686&pid=S0798-2259200600060000800005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><FONT COLOR="000000">6. BEGGS, M.L.; CAVE, M.D.; MARLOWE, C.; CLONEY, L.; DUCK, P.; EISENACH, K.D.  Characterization of <I>Mycobacterium tuberculosis</I> complex direct repeat sequence  for use in cycling probe reaction. <B>J. Clin. Microbiol. </B>34: 2985-2989. 1996. </FONT></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567687&pid=S0798-2259200600060000800006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">7. BEHR, M.A.; WILSON, M.A.; GILL, W.P.; SALAMON, H.; SCHOOLNIK, G.K.; RANE,  S.; SMALL, P.M. Comparative Genomics of BCG Vaccines by whole-genome DNA  microarray. <B>Science </B>284: 1520-1523. 1999. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567688&pid=S0798-2259200600060000800007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">8. BLASQUEZ, J.; ESPINOSA DE LOS MONTEROS, L.E.; SAMPER, S.; MARTÍN, C.; GUERRERO,  A.; COBO, J.; VAN EMBDEN, J.D.; BAQUERO, F.; GÓMEZ-MAMPASO, E. Genetic  characterization of multidrug-resistant <I>Mycobacterium bovis</I> strains from  a hospital outbreak involving human immunodeficincy virus-positive patients.  <B>J. Clin. Microbiol. </B>35: 1390-1393. 1997. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567689&pid=S0798-2259200600060000800008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">9. BROSCH, R.; GORDON, S.V.; MARMIESSE, M.; BRODIN, P.; BUCHRIESER, C.; EIGLMEIER,  K.; GARNIER, T.; GUTIERREZ, C.; HEWINSON, G.; KREMER, K.; PARSONS, L.M.;  PYM, A.S.; SAMPER, S.; VAN SOOLINGEN, D.; COLE, S.T. A new evolutionary  scenario for the <I>Mycobacterium tuberculosis</I> complex. <B>Proc. Natl. Acad.  Sci.</B> USA, 99: 3684-3689. 2002. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567690&pid=S0798-2259200600060000800009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">10.</font> <FONT COLOR="000000">FRITSCHE, A.; ENGEL, R.; BUHL, D.; ZELLWEGER, J.P. <I>Mycobacterium bovis</I>  tuberculosis: from animal to man and back. <B>Int. J. Tuberc. Lung Dis.</B> 8:  903-904. 2004. </FONT></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567691&pid=S0798-2259200600060000800010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">11. GIBSON, A.L.; HEWINSON, G.; GOODCHILD, T.; WATT, B.; STORY, A.; INWALD,  J.; DROBNIEWSKI, F.A. Molecular epidemiology of disease due to <I>Mycobacterium  bovis</I> in humans in the United Kingdom. <B>J. Clin. Microbiol.</B> 42: 431-434.  2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567692&pid=S0798-2259200600060000800011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">12. GORDON, S.V.; BROSCH, R.; BILLAUT, A.; GARNIER, T.; EIGLMEIR, K.; COLE,  S.T. Identification of variable regions in the genomes of tubercle bacilli  using bacterial artificial chromosomes arrays.<B> Mol. Microbiol</B>. 32: 643-655.  1999. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567693&pid=S0798-2259200600060000800012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">13. GUTIÉRREZ, M.; SAMPER, S.; JIMENEZ, M.S.; VAN EMBDEN, J.D.; MARÍN, J.F.;  MARTÍN, C. Identification for spoligotyping of a caprine genotype in <I>Mycobacterium  bovis</I> strain causing human tuberculosis. <B>J. Clin. Microbiol.</B> 35: 3328-3330.  1997. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567694&pid=S0798-2259200600060000800013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">14. HESSELING, A.C.; SCHAAF, H.S.; VICTOR, T.; BEYERS, N.; MARAIS, B.J.; COTTON,  M.F.; WIID, I.; GIE, R.P.; VAN HELDEN, P.; WARREN, R.M. Resistant <I>Mycobacterium  bovis</I> Bacillus Calmette-Guerin disease: implications for management of  Bacillus Calmette-Guerin Disease in human immunodeficiency virus-infected  children. <B>Pediatr. Infect. Dis. J.</B> 5: 476-479. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567695&pid=S0798-2259200600060000800014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">15. HORSTKOTTE, M.A.; SOBOTTKA, I.; SCHEWE, C.K.; SCAFER, P.; LAUFS, R.; RUSCH-GERDES,  S.; NIEMANN, S. <I>Mycobacterium microti</I> llama-type infection presenting as  pulmonary tuberculosis in a human immunodeficiency virus positive-patient.  <B>J. Clin. Microbiol. </B>39: 406-407. 2001. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567696&pid=S0798-2259200600060000800015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">16. HUARD, R.C.; DE OLIVEIRA, L.C.; BUTLER, R.; VAN SOOLINGEN, D.; HO, J.L.  PCR-based method to differentiate the subspecies of the <I>Mycobacterium tuberculosis</I>  complex on the basis of genomic deletions. <B>J. Clin. Microbiol. </B>41: 1637-1650.  2003. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567697&pid=S0798-2259200600060000800016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">17. MOSTOWY, S.; COUSINS, D.; BEHR, M.A. Genomic interrogation of the dassie  bacillus reveals it as a unique RD1 mutant within the <I>Mycobacterium tuberculosis</I>  complex. <B>J. Bacteriol.</B>186: 104-109. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567698&pid=S0798-2259200600060000800017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">18. MOSTOWY, S.; COUSINS, D.; BRINKMAN, J.; ARANAZ, A.; BEHR, M.A. Genomics  deletions suggest a phylogeny for the <I>Mycobacterium tuberculosis</I> complex.  <B>J. Infect. Dis. </B>186: 74-80. 2002. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567699&pid=S0798-2259200600060000800018&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">19. NIEMANN, S.; RICHTER, E.; RUSCH-GERDES, S. Differentiation among members  of the <I>Mycobacterium tuberculosis</I> complex by molecular and biochemical  features: evidence for two pirazynamide-susceptible subtypes of <I>M. bovis</I>.  <B>J. Clin. Microbiol. </B>38: 152-157. 2000. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567700&pid=S0798-2259200600060000800019&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">20. PARK, H.; JANG, H.; KIM, C.; CHUNG, B.; CHAN, C.; PARK, S.K.; SONG, S.  Detection and identification of Mycobacteria by amplification of the internal  transcribed spacer regions with genus-and species-especific PCR primers.  <B>J. Clin. Microbiol.</B> 38: 4080-4085. 2000. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567701&pid=S0798-2259200600060000800020&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">21. PARRA, C.A.; LONDOÑO, L.P.; DEL PORTILLO, P.; PATARROYO, M.E. Isolation,  characterization and molecular cloning of a specific <I>Mycobacterium tuberculosis</I>  antigen gen: identification of a species-specific sequence. <B>Infect. Immun.  </B>59: 3411-3417. 1991. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567702&pid=S0798-2259200600060000800021&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">22. PARSONS, L.M.; BROSCH, R.; COLE, S.T.; SOMOSKOVI, A.; LODER, A.; BRETZEL,  G.; VAN SOOLINGEN, D.; HALE, Y.M.; SALFINGER, M. Rapid and simple approach  for identification of <I>Mycobacterium tuberculosis</I> complex isolates by PCR-based  genomic deletions analysis. <B>J. Clin. Microbiol.</B> 40: 2239-2345. 2002. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567703&pid=S0798-2259200600060000800022&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">23. PRABHAKAR, S.; MISHRA, A.; SINGHAL, A.; KATOCH, M.; THAKRAL, S.; TYAGI,  J.S.; PRADSAD, H.K. Use of the <I>hupB</I> gene coding a histone-like protein  of <I>Mycobacterium tuberculosis</I> as a target for detection and differentiation  of <I>M: tuberculosis</I> and <I>M. bovis</I>. <B>J. Clin. Microbiol. </B>42: 2724-2732. 2004. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567704&pid=S0798-2259200600060000800023&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">24. RODRIGUEZ, J.G.; MEJÍA, G.A.; DEL PORTILLO, P.; PATARROYO, M.E.; MURILLO,  L.A. Specie-specific identification of <I>Mycobacterium bovi</I>s by PCR. <B>Microbiol. </B>141: 2131-2138. 1995. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567705&pid=S0798-2259200600060000800024&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">25. SAMPER, S.; MARTÍN, C.; PINEDO, A.; RIVERO, A.; BLÁSQUEZ, J.; BAQUERO, F.;  VAN SOOLINGEN, D.; VAN EMBDEN, J.D. Transmission between HIV-infected patients  of multidrug-resistant tuberculosis caused by <I>Mycobacterium bovis</I>. <B>AIDS</B>  11: 1237-1242. 1997. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567706&pid=S0798-2259200600060000800025&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">26. SCORPIO, A.; ZHANG, Y. Mutations in <I>pncA</I>, a gene encoding pyrazinamidase/nicotinamidase,  cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.  <B>Nat. Med.</B> 2: 662-667. 1996. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567707&pid=S0798-2259200600060000800026&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">27. VAN EMBDEN, J.D.; VAN GORKOM, D.T.; KREMER, K.; JANSEN, R.; VAN DER ZEIJST,  B.A.; SHOULS, L.M. Genetic variation and evolutionary origin of the direct  repeat locus of <I>Mycobacterium tuberculosis</I> complex bacteria. <B>J. Bacteriol.</B>  182: 2393-2401. 2000. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567708&pid=S0798-2259200600060000800027&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">28. VAN SOOLINGEN, D.; HAAS, P.E.; HERMANS, P.W.; GROENEN, P.M.; VAN EMBDEN,  J.D. Comparison of various repetitive DNA elements as genetic markers for  strain differentiation and epidemiology of <I>Mycobacterium tuberculosis</I>.  <B>J. Clin. Microbiol. </B>31: 1987-1995. 1993. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567709&pid=S0798-2259200600060000800028&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">29. VAN SOOLINGEN, D.; HOOGENBOEZEM, T.; DE HAAS, P.E.; HERMANS, P.W.; KOEDAM,  M.A.; TEPPEMA, K.S.; BRENNAN, P.J.; BESRA, G.S.; PORTAELS F.; TOP, J.;  SHOULS, L.M.; VAN EMBDEN, J.D. A novel pathogenic taxon of the <I>Mycobacterium  tuberculosis</I> complex, Canetti: characterization of an exceptional isolated  from Africa. <B>Int. J. Syst. Bacteriol</B>. 47:1236-1245. 1997. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567710&pid=S0798-2259200600060000800029&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">30. VAN SOOLINGEN, D.; VAN DER ZANDEN, A.G.; HAAS, P.E.; NOORDHOEK, G.T.; KIERS,  A.; FOUDRAINE, N.A.; PORTAELS, F.; KOLK, A.H.; KREMER, K.; VAN EMBDEN,  J.D. Diagnosis of <I>Mycobacterium microti</I> infections among humans by using  novel genetic markers. <B>J. Clin. Microbiol.</B> 36: 1840-1845. 1998. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567711&pid=S0798-2259200600060000800030&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">31. VLASPODER, F.; SINGER, P.; ROGGEVEEN, C. Diagnostic value of a amplification  method (Gen Probe) compared with that of culture for diagnosis of tuberculosis.  <B>J. Clin. Microbiol.</B> 33: 2699-2703. 1995. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567712&pid=S0798-2259200600060000800031&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">32. WAYNE, L.G.; KUBICA, G.P. The Mycobacteria. In the P.H.A Sneath and J.G.  Holt (Eds). <B>Bergey’s manual of systematic bacteriology,</B> The Williams  Wilkins  Co., Baltimore, Md. Vol. 2, 1435-1457 pp. 1992. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567713&pid=S0798-2259200600060000800032&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">33. WEIL, A.; PLIKAYTIS, B.B.; BUTLER, W.R.; WODLEY, C.I.; SHINNICK, T.M. The  <I>mtp40</I> gene is not present in all strain of <I>Mycobacterium tuberculosis</I>.<B>  J. Clin. Microbiol. </B>34: 2309-2311. 1996. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567714&pid=S0798-2259200600060000800033&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">34. WILLIAMS, D.L.; GILLIS, T.P.; DUPREE, W.G<B>. </B>Ethanol fixation of sputum sediments  for DNA-based detection of <I>Mycobacterium tuberculosis</I>. <B>J. Clin. Microbiol.</B>  33: 1558-1561. 1995. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567715&pid=S0798-2259200600060000800034&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">35. ZUMÁRRAGA, M.; BIGI, F.; ALITO, A.; ROMANO, M.I.; CATALDI, A. A 12,7 Kb  fragment of the <I>Mycobacterium tuberculosis</I> genome is not present in <I>Mycobacterium  bovis</I>. <B>Microbiol. </B>145: 893-897. 1999. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567716&pid=S0798-2259200600060000800035&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P align="justify" style="word-spacing: 0; line-height: 100%"><font face="Verdana" size="2"><font color="000000">36. ZUMÁRRAGA, M.J.; MARTIN, C.; SAMPER, S.; ALITO, A.; LATINI, O.; BIGI, F.;  ROXO, E.; CICUTA, M.E.; ERRICO, F.; CASTRO, M.; CATALDI, A.; VAN SOOLINGEN,  D.; ROMANO, M.I. Usefulness of Spoligotyping in molecular epidemiology  of <I>Mycobacterium bovis-</I>related infections in South America. <B>Microbiol. </B>145: 893-897. 1999. </font></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1567717&pid=S0798-2259200600060000800036&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --> ]]></body>
<back>
<ref-list>
<ref id="B1">
<label>1</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ABALOS]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[RETAMAL]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Tuberculosis: a re-emerging zoonosis?]]></article-title>
<source><![CDATA[Rev. Sci. Tech.]]></source>
<year>2004</year>
<volume>23</volume>
<page-range>583-594</page-range></nlm-citation>
</ref>
<ref id="B2">
<label>2</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[AUSUBEL]]></surname>
<given-names><![CDATA[F.M]]></given-names>
</name>
</person-group>
<source><![CDATA[Short Protocols in Molecular Biology]]></source>
<year>1992</year>
<edition>2da</edition>
<page-range>680</page-range><publisher-loc><![CDATA[New York ]]></publisher-loc>
<publisher-name><![CDATA[John Wiley Sons, Inc]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B3">
<label>3</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[AYELE]]></surname>
<given-names><![CDATA[W.Y.]]></given-names>
</name>
<name>
<surname><![CDATA[NEILL]]></surname>
<given-names><![CDATA[S.D.]]></given-names>
</name>
<name>
<surname><![CDATA[ZINSSTAG]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[WEISS]]></surname>
<given-names><![CDATA[M.G.]]></given-names>
</name>
<name>
<surname><![CDATA[PAVLIK]]></surname>
<given-names><![CDATA[I]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Bovine tuberculosis: an old disease but a new threat to Africa]]></article-title>
<source><![CDATA[Int. J. Tuberc. Lung Dis.]]></source>
<year>2004</year>
<volume>8</volume>
<page-range>924-937</page-range></nlm-citation>
</ref>
<ref id="B4">
<label>4</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BAROUNI]]></surname>
<given-names><![CDATA[A.S.]]></given-names>
</name>
<name>
<surname><![CDATA[AUGUSTO]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[QUEIROZ]]></surname>
<given-names><![CDATA[M.V.]]></given-names>
</name>
<name>
<surname><![CDATA[LOPES]]></surname>
<given-names><![CDATA[M.T.]]></given-names>
</name>
<name>
<surname><![CDATA[ZANINI]]></surname>
<given-names><![CDATA[M.S.]]></given-names>
</name>
<name>
<surname><![CDATA[SALAS]]></surname>
<given-names><![CDATA[C.E]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[BCG lymphadenopathy detected in a BCG-vaccinated infant]]></article-title>
<source><![CDATA[Braz J. Med. Biol. Res.]]></source>
<year>2004</year>
<volume>37</volume>
<page-range>697-700</page-range></nlm-citation>
</ref>
<ref id="B5">
<label>5</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BEAVIS]]></surname>
<given-names><![CDATA[K.G.]]></given-names>
</name>
<name>
<surname><![CDATA[LICHTY]]></surname>
<given-names><![CDATA[M.B.]]></given-names>
</name>
<name>
<surname><![CDATA[JUNGKIND]]></surname>
<given-names><![CDATA[D.J.]]></given-names>
</name>
<name>
<surname><![CDATA[GIGER]]></surname>
<given-names><![CDATA[O]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Evaluation of Amplicor PCR for direct detection of M: tuberculosis from sputum specimens]]></article-title>
<source><![CDATA[J. Clin Microbiol.]]></source>
<year>1995</year>
<volume>33</volume>
<page-range>2582-2585</page-range></nlm-citation>
</ref>
<ref id="B6">
<label>6</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BEGGS]]></surname>
<given-names><![CDATA[M.L.]]></given-names>
</name>
<name>
<surname><![CDATA[CAVE]]></surname>
<given-names><![CDATA[M.D.]]></given-names>
</name>
<name>
<surname><![CDATA[MARLOWE]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[CLONEY]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[DUCK]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[EISENACH]]></surname>
<given-names><![CDATA[K.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Characterization of Mycobacterium tuberculosis complex direct repeat sequence for use in cycling probe reaction]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1996</year>
<volume>34</volume>
<page-range>2985-2989</page-range></nlm-citation>
</ref>
<ref id="B7">
<label>7</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BEHR]]></surname>
<given-names><![CDATA[M.A.]]></given-names>
</name>
<name>
<surname><![CDATA[WILSON]]></surname>
<given-names><![CDATA[M.A.]]></given-names>
</name>
<name>
<surname><![CDATA[GILL]]></surname>
<given-names><![CDATA[W.P.]]></given-names>
</name>
<name>
<surname><![CDATA[SALAMON]]></surname>
<given-names><![CDATA[H.]]></given-names>
</name>
<name>
<surname><![CDATA[SCHOOLNIK]]></surname>
<given-names><![CDATA[G.K.]]></given-names>
</name>
<name>
<surname><![CDATA[RANE]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[SMALL]]></surname>
<given-names><![CDATA[P.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Comparative Genomics of BCG Vaccines by whole-genome DNA microarray]]></article-title>
<source><![CDATA[Science]]></source>
<year>1999</year>
<volume>284</volume>
<page-range>1520-1523</page-range></nlm-citation>
</ref>
<ref id="B8">
<label>8</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BLASQUEZ]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[ESPINOSA DE LOS MONTEROS]]></surname>
<given-names><![CDATA[L.E.]]></given-names>
</name>
<name>
<surname><![CDATA[SAMPER]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTÍN]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[GUERRERO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[COBO]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D.]]></given-names>
</name>
<name>
<surname><![CDATA[BAQUERO]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[GÓMEZ-MAMPASO]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genetic characterization of multidrug-resistant Mycobacterium bovis strains from a hospital outbreak involving human immunodeficincy virus-positive patients]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1997</year>
<volume>35</volume>
<page-range>1390-1393</page-range></nlm-citation>
</ref>
<ref id="B9">
<label>9</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BROSCH]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[GORDON]]></surname>
<given-names><![CDATA[S.V.]]></given-names>
</name>
<name>
<surname><![CDATA[MARMIESSE]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[BRODIN]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[BUCHRIESER]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[EIGLMEIER]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[GARNIER]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[GUTIERREZ]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[HEWINSON]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[KREMER]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[PARSONS]]></surname>
<given-names><![CDATA[L.M.]]></given-names>
</name>
<name>
<surname><![CDATA[PYM]]></surname>
<given-names><![CDATA[A.S.]]></given-names>
</name>
<name>
<surname><![CDATA[SAMPER]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[COLE]]></surname>
<given-names><![CDATA[S.T]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A new evolutionary scenario for the Mycobacterium tuberculosis complex]]></article-title>
<source><![CDATA[Proc. Natl. Acad. Sci. USA,]]></source>
<year>2002</year>
<volume>99</volume>
<page-range>3684-3689</page-range></nlm-citation>
</ref>
<ref id="B10">
<label>10</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[FRITSCHE]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[ENGEL]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[BUHL]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[ZELLWEGER]]></surname>
<given-names><![CDATA[J.P]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Mycobacterium bovis tuberculosis: from animal to man and back]]></article-title>
<source><![CDATA[Int. J. Tuberc. Lung Dis.]]></source>
<year>2004</year>
<volume>8</volume>
<page-range>903-904</page-range></nlm-citation>
</ref>
<ref id="B11">
<label>11</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GIBSON]]></surname>
<given-names><![CDATA[A.L.]]></given-names>
</name>
<name>
<surname><![CDATA[HEWINSON]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[GOODCHILD]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[WATT]]></surname>
<given-names><![CDATA[B.]]></given-names>
</name>
<name>
<surname><![CDATA[STORY]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[INWALD]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[DROBNIEWSKI]]></surname>
<given-names><![CDATA[F.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United Kingdom]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>2004</year>
<volume>42</volume>
<page-range>431-434</page-range></nlm-citation>
</ref>
<ref id="B12">
<label>12</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GORDON]]></surname>
<given-names><![CDATA[S.V.]]></given-names>
</name>
<name>
<surname><![CDATA[BROSCH]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[BILLAUT]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[GARNIER]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[EIGLMEIR]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[COLE]]></surname>
<given-names><![CDATA[S.T]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosomes arrays]]></article-title>
<source><![CDATA[Mol. Microbiol.]]></source>
<year>1999</year>
<volume>32</volume>
<page-range>643-655</page-range></nlm-citation>
</ref>
<ref id="B13">
<label>13</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GUTIÉRREZ]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[SAMPER]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[JIMENEZ]]></surname>
<given-names><![CDATA[M.S.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D.]]></given-names>
</name>
<name>
<surname><![CDATA[MARÍN]]></surname>
<given-names><![CDATA[J.F.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTÍN]]></surname>
<given-names><![CDATA[C]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Identification for spoligotyping of a caprine genotype in Mycobacterium bovis strain causing human tuberculosis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1997</year>
<volume>35</volume>
<page-range>3328-3330</page-range></nlm-citation>
</ref>
<ref id="B14">
<label>14</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[HESSELING]]></surname>
<given-names><![CDATA[A.C.]]></given-names>
</name>
<name>
<surname><![CDATA[SCHAAF]]></surname>
<given-names><![CDATA[H.S.]]></given-names>
</name>
<name>
<surname><![CDATA[VICTOR]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[BEYERS]]></surname>
<given-names><![CDATA[N.]]></given-names>
</name>
<name>
<surname><![CDATA[MARAIS]]></surname>
<given-names><![CDATA[B.J.]]></given-names>
</name>
<name>
<surname><![CDATA[COTTON]]></surname>
<given-names><![CDATA[M.F.]]></given-names>
</name>
<name>
<surname><![CDATA[WIID]]></surname>
<given-names><![CDATA[I.]]></given-names>
</name>
<name>
<surname><![CDATA[GIE]]></surname>
<given-names><![CDATA[R.P.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN HELDEN]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[WARREN]]></surname>
<given-names><![CDATA[R.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Resistant Mycobacterium bovis Bacillus Calmette-Guerin disease: implications for management of Bacillus Calmette-Guerin Disease in human immunodeficiency virus-infected children]]></article-title>
<source><![CDATA[Pediatr. Infect. Dis. J.]]></source>
<year>2004</year>
<volume>5</volume>
<page-range>476-479</page-range></nlm-citation>
</ref>
<ref id="B15">
<label>15</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[HORSTKOTTE]]></surname>
<given-names><![CDATA[M.A.]]></given-names>
</name>
<name>
<surname><![CDATA[SOBOTTKA]]></surname>
<given-names><![CDATA[I.]]></given-names>
</name>
<name>
<surname><![CDATA[SCHEWE]]></surname>
<given-names><![CDATA[C.K.]]></given-names>
</name>
<name>
<surname><![CDATA[SCAFER]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[LAUFS]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[RUSCH-GERDES]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[NIEMANN]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Mycobacterium microti llama-type infection presenting as pulmonary tuberculosis in a human immunodeficiency virus positive-patient]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>2001</year>
<volume>39</volume>
<page-range>406-407</page-range></nlm-citation>
</ref>
<ref id="B16">
<label>16</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[HUARD]]></surname>
<given-names><![CDATA[R.C.]]></given-names>
</name>
<name>
<surname><![CDATA[DE OLIVEIRA]]></surname>
<given-names><![CDATA[L.C.]]></given-names>
</name>
<name>
<surname><![CDATA[BUTLER]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[HO]]></surname>
<given-names><![CDATA[J.L]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[PCR-based method to differentiate the subspecies of the Mycobacterium tuberculosis complex on the basis of genomic deletions]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>2003</year>
<volume>41</volume>
<page-range>1637-1650</page-range></nlm-citation>
</ref>
<ref id="B17">
<label>17</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MOSTOWY]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[COUSINS]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[BEHR]]></surname>
<given-names><![CDATA[M.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genomic interrogation of the dassie bacillus reveals it as a unique RD1 mutant within the Mycobacterium tuberculosis complex]]></article-title>
<source><![CDATA[J.]]></source>
<year>2004</year>
<volume>Bacteriol.186</volume>
<page-range>104-109</page-range></nlm-citation>
</ref>
<ref id="B18">
<label>18</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MOSTOWY]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[COUSINS]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[BRINKMAN]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[ARANAZ]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[BEHR]]></surname>
<given-names><![CDATA[M.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genomics deletions suggest a phylogeny for the Mycobacterium tuberculosis complex]]></article-title>
<source><![CDATA[J. Infect. Dis.]]></source>
<year>2002</year>
<volume>186</volume>
<page-range>74-80</page-range></nlm-citation>
</ref>
<ref id="B19">
<label>19</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[NIEMANN]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[RICHTER]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[RUSCH-GERDES]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Differentiation among members of the Mycobacterium tuberculosis complex by molecular and biochemical features: evidence for two pirazynamide-susceptible subtypes of M]]></article-title>
<source><![CDATA[bovis. J. Clin. Microbiol.]]></source>
<year>2000</year>
<volume>38</volume>
<page-range>152-157</page-range></nlm-citation>
</ref>
<ref id="B20">
<label>20</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[PARK]]></surname>
<given-names><![CDATA[H.]]></given-names>
</name>
<name>
<surname><![CDATA[JANG]]></surname>
<given-names><![CDATA[H.]]></given-names>
</name>
<name>
<surname><![CDATA[KIM]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[CHUNG]]></surname>
<given-names><![CDATA[B.]]></given-names>
</name>
<name>
<surname><![CDATA[CHAN]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[PARK]]></surname>
<given-names><![CDATA[S.K.]]></given-names>
</name>
<name>
<surname><![CDATA[SONG]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Detection and identification of Mycobacteria by amplification of the internal transcribed spacer regions with genus-and species-especific PCR primers]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>2000</year>
<volume>38</volume>
<page-range>4080-4085</page-range></nlm-citation>
</ref>
<ref id="B21">
<label>21</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[PARRA]]></surname>
<given-names><![CDATA[C.A.]]></given-names>
</name>
<name>
<surname><![CDATA[LONDOÑO]]></surname>
<given-names><![CDATA[L.P.]]></given-names>
</name>
<name>
<surname><![CDATA[DEL PORTILLO]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[PATARROYO]]></surname>
<given-names><![CDATA[M.E]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Isolation, characterization and molecular cloning of a specific Mycobacterium tuberculosis antigen gen: identification of a species-specific sequence]]></article-title>
<source><![CDATA[Infect. Immun.]]></source>
<year>1991</year>
<volume>59</volume>
<page-range>3411-3417</page-range></nlm-citation>
</ref>
<ref id="B22">
<label>22</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[PARSONS]]></surname>
<given-names><![CDATA[L.M.]]></given-names>
</name>
<name>
<surname><![CDATA[BROSCH]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[COLE]]></surname>
<given-names><![CDATA[S.T.]]></given-names>
</name>
<name>
<surname><![CDATA[SOMOSKOVI]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[LODER]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[BRETZEL]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[HALE]]></surname>
<given-names><![CDATA[Y.M.]]></given-names>
</name>
<name>
<surname><![CDATA[SALFINGER]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Rapid and simple approach for identification of Mycobacterium tuberculosis complex isolates by PCR-based genomic deletions analysis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>2002</year>
<volume>40</volume>
<page-range>2239-2345</page-range></nlm-citation>
</ref>
<ref id="B23">
<label>23</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[PRABHAKAR]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[MISHRA]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[SINGHAL]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[KATOCH]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[THAKRAL]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[TYAGI]]></surname>
<given-names><![CDATA[J.S.]]></given-names>
</name>
<name>
<surname><![CDATA[PRADSAD]]></surname>
<given-names><![CDATA[H.K]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Use of the hupB gene coding a histone-like protein of Mycobacterium tuberculosis as a target for detection and differentiation of M: tuberculosis and M]]></article-title>
<source><![CDATA[bovis. J. Clin. Microbiol.]]></source>
<year>2004</year>
<volume>42</volume>
<page-range>2724-2732</page-range></nlm-citation>
</ref>
<ref id="B24">
<label>24</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[RODRIGUEZ]]></surname>
<given-names><![CDATA[J.G.]]></given-names>
</name>
<name>
<surname><![CDATA[MEJÍA]]></surname>
<given-names><![CDATA[G.A.]]></given-names>
</name>
<name>
<surname><![CDATA[DEL PORTILLO]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[PATARROYO]]></surname>
<given-names><![CDATA[M.E.]]></given-names>
</name>
<name>
<surname><![CDATA[MURILLO]]></surname>
<given-names><![CDATA[L.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Specie-specific identification of Mycobacterium bovis by PCR]]></article-title>
<source><![CDATA[Microbiol.]]></source>
<year>1995</year>
<volume>141</volume>
<page-range>2131-2138</page-range></nlm-citation>
</ref>
<ref id="B25">
<label>25</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SAMPER]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTÍN]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[PINEDO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[RIVERO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[BLÁSQUEZ]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[BAQUERO]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Transmission between HIV-infected patients of multidrug-resistant tuberculosis caused by Mycobacterium bovis]]></article-title>
<source><![CDATA[AIDS]]></source>
<year>1997</year>
<volume>11</volume>
<page-range>1237-1242</page-range></nlm-citation>
</ref>
<ref id="B26">
<label>26</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SCORPIO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[ZHANG]]></surname>
<given-names><![CDATA[Y]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus]]></article-title>
<source><![CDATA[Nat. Med.]]></source>
<year>1996</year>
<volume>2</volume>
<page-range>662-667</page-range></nlm-citation>
</ref>
<ref id="B27">
<label>27</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN GORKOM]]></surname>
<given-names><![CDATA[D.T.]]></given-names>
</name>
<name>
<surname><![CDATA[KREMER]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[JANSEN]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN DER ZEIJST]]></surname>
<given-names><![CDATA[B.A.]]></given-names>
</name>
<name>
<surname><![CDATA[SHOULS]]></surname>
<given-names><![CDATA[L.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genetic variation and evolutionary origin of the direct repeat locus of Mycobacterium tuberculosis complex bacteria]]></article-title>
<source><![CDATA[J. Bacteriol.]]></source>
<year>2000</year>
<volume>182</volume>
<page-range>2393-2401</page-range></nlm-citation>
</ref>
<ref id="B28">
<label>28</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[HAAS]]></surname>
<given-names><![CDATA[P.E.]]></given-names>
</name>
<name>
<surname><![CDATA[HERMANS]]></surname>
<given-names><![CDATA[P.W.]]></given-names>
</name>
<name>
<surname><![CDATA[GROENEN]]></surname>
<given-names><![CDATA[P.M.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Comparison of various repetitive DNA elements as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1993</year>
<volume>31</volume>
<page-range>1987-1995</page-range></nlm-citation>
</ref>
<ref id="B29">
<label>29</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[HOOGENBOEZEM]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[DE HAAS]]></surname>
<given-names><![CDATA[P.E.]]></given-names>
</name>
<name>
<surname><![CDATA[HERMANS]]></surname>
<given-names><![CDATA[P.W.]]></given-names>
</name>
<name>
<surname><![CDATA[KOEDAM]]></surname>
<given-names><![CDATA[M.A.]]></given-names>
</name>
<name>
<surname><![CDATA[TEPPEMA]]></surname>
<given-names><![CDATA[K.S.]]></given-names>
</name>
<name>
<surname><![CDATA[BRENNAN]]></surname>
<given-names><![CDATA[P.J.]]></given-names>
</name>
<name>
<surname><![CDATA[BESRA]]></surname>
<given-names><![CDATA[G.S.]]></given-names>
</name>
<name>
<surname><![CDATA[PORTAELS]]></surname>
<given-names><![CDATA[F]]></given-names>
</name>
<name>
<surname><![CDATA[TOP]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[SHOULS]]></surname>
<given-names><![CDATA[L.M.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A novel pathogenic taxon of the Mycobacterium tuberculosis complex, Canetti: characterization of an exceptional isolated from Africa]]></article-title>
<source><![CDATA[Int. J. Syst. Bacteriol.]]></source>
<year>1997</year>
<volume>47</volume>
<page-range>1236-1245</page-range></nlm-citation>
</ref>
<ref id="B30">
<label>30</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN DER ZANDEN]]></surname>
<given-names><![CDATA[A.G.]]></given-names>
</name>
<name>
<surname><![CDATA[HAAS]]></surname>
<given-names><![CDATA[P.E.]]></given-names>
</name>
<name>
<surname><![CDATA[NOORDHOEK]]></surname>
<given-names><![CDATA[G.T.]]></given-names>
</name>
<name>
<surname><![CDATA[KIERS]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[FOUDRAINE]]></surname>
<given-names><![CDATA[N.A.]]></given-names>
</name>
<name>
<surname><![CDATA[PORTAELS]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[KOLK]]></surname>
<given-names><![CDATA[A.H.]]></given-names>
</name>
<name>
<surname><![CDATA[KREMER]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN EMBDEN]]></surname>
<given-names><![CDATA[J.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Diagnosis of Mycobacterium microti infections among humans by using novel genetic markers]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1998</year>
<volume>36</volume>
<page-range>1840-1845</page-range></nlm-citation>
</ref>
<ref id="B31">
<label>31</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VLASPODER]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[SINGER]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[ROGGEVEEN]]></surname>
<given-names><![CDATA[C]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Diagnostic value of a amplification method (Gen Probe) compared with that of culture for diagnosis of tuberculosis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1995</year>
<volume>33</volume>
<page-range>2699-2703</page-range></nlm-citation>
</ref>
<ref id="B32">
<label>32</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[WAYNE]]></surname>
<given-names><![CDATA[L.G]]></given-names>
</name>
<name>
<surname><![CDATA[KUBICA]]></surname>
<given-names><![CDATA[G.P]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The Mycobacteria]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Sneath]]></surname>
<given-names><![CDATA[P.H.A]]></given-names>
</name>
<name>
<surname><![CDATA[Holt]]></surname>
<given-names><![CDATA[J.G]]></given-names>
</name>
</person-group>
<source><![CDATA[Bergey’s manual of systematic bacteriology]]></source>
<year>1992</year>
<volume>2</volume>
<page-range>1435-1457</page-range><publisher-loc><![CDATA[Baltimore ]]></publisher-loc>
<publisher-name><![CDATA[The Williams Wilkins Co]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B33">
<label>33</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[WEIL]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[PLIKAYTIS]]></surname>
<given-names><![CDATA[B.B.]]></given-names>
</name>
<name>
<surname><![CDATA[BUTLER]]></surname>
<given-names><![CDATA[W.R.]]></given-names>
</name>
<name>
<surname><![CDATA[WODLEY]]></surname>
<given-names><![CDATA[C.I.]]></given-names>
</name>
<name>
<surname><![CDATA[SHINNICK]]></surname>
<given-names><![CDATA[T.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The mtp40 gene is not present in all strain of Mycobacterium tuberculosis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1996</year>
<volume>34</volume>
<page-range>2309-2311</page-range></nlm-citation>
</ref>
<ref id="B34">
<label>34</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[WILLIAMS]]></surname>
<given-names><![CDATA[D.L.]]></given-names>
</name>
<name>
<surname><![CDATA[GILLIS]]></surname>
<given-names><![CDATA[T.P.]]></given-names>
</name>
<name>
<surname><![CDATA[DUPREE]]></surname>
<given-names><![CDATA[W.G]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Ethanol fixation of sputum sediments for DNA-based detection of Mycobacterium tuberculosis]]></article-title>
<source><![CDATA[J. Clin. Microbiol.]]></source>
<year>1995</year>
<volume>33</volume>
<page-range>1558-1561</page-range></nlm-citation>
</ref>
<ref id="B35">
<label>35</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ZUMÁRRAGA]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[BIGI]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[ALITO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[ROMANO]]></surname>
<given-names><![CDATA[M.I.]]></given-names>
</name>
<name>
<surname><![CDATA[CATALDI]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A 12,7 Kb fragment of the Mycobacterium tuberculosis genome is not present in Mycobacterium bovis]]></article-title>
<source><![CDATA[Microbiol.]]></source>
<year>1999</year>
<volume>145</volume>
<page-range>893-897</page-range></nlm-citation>
</ref>
<ref id="B36">
<label>36</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ZUMÁRRAGA]]></surname>
<given-names><![CDATA[M.J.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTIN]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[SAMPER]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[ALITO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[LATINI]]></surname>
<given-names><![CDATA[O.]]></given-names>
</name>
<name>
<surname><![CDATA[BIGI]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[ROXO]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[CICUTA]]></surname>
<given-names><![CDATA[M.E.]]></given-names>
</name>
<name>
<surname><![CDATA[ERRICO]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[CASTRO]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[CATALDI]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN SOOLINGEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[ROMANO]]></surname>
<given-names><![CDATA[M.I]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Usefulness of Spoligotyping in molecular epidemiology of Mycobacterium bovis-related infections in South America]]></article-title>
<source><![CDATA[Microbiol.]]></source>
<year>1999</year>
<volume>145</volume>
<page-range>893-897</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
