<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>0798-2259</journal-id>
<journal-title><![CDATA[Revista Científica]]></journal-title>
<abbrev-journal-title><![CDATA[Rev. Cient. (Maracaibo)]]></abbrev-journal-title>
<issn>0798-2259</issn>
<publisher>
<publisher-name><![CDATA[UNIVERSIDAD DEL ZULIA]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S0798-22592010000100008</article-id>
<title-group>
<article-title xml:lang="es"><![CDATA[Importancia de la verificación-asignación de progenitores en sistemas extensivos de pie de cría]]></article-title>
<article-title xml:lang="en"><![CDATA[Importance of parentage verification-assignment in extensive multiple-sired breeding herds]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Arellano-Vera]]></surname>
<given-names><![CDATA[Williams]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Sifuentes-Rincón]]></surname>
<given-names><![CDATA[Ana María]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Garcidueñas-Piña]]></surname>
<given-names><![CDATA[Rogelio]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Parra-Bracamonte]]></surname>
<given-names><![CDATA[Gaspar Manuel]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Instituto Politécnico Nacional Centro de Biotecnología Genómica Laboratorio de Biotecnología Animal]]></institution>
<addr-line><![CDATA[ ]]></addr-line>
<country>México</country>
</aff>
<aff id="A02">
<institution><![CDATA[,, Universidad Michoacana de San Nicolás de Hidalgo Facultad de Medicina Veterinaria y Zootecnia ]]></institution>
<addr-line><![CDATA[ Michoacán]]></addr-line>
<country>México</country>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>02</month>
<year>2010</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>02</month>
<year>2010</year>
</pub-date>
<volume>20</volume>
<numero>1</numero>
<fpage>53</fpage>
<lpage>60</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S0798-22592010000100008&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_abstract&amp;pid=S0798-22592010000100008&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_pdf&amp;pid=S0798-22592010000100008&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="es"><p><![CDATA[Se aplicó un panel de nueve marcadores microsatélites para estructurar la genealogía de un hato de ganado Braford manejado bajo empadre múltiple y destinado a pié de cría, para evaluar las repercusiones de la adecuada asignación de progenitores, así como las implicaciones en su mejoramiento genético. Se logró la asignación de paternidad en el 100% de la progenie, mientras que en los ensayos de verificación de maternidad se estimó un porcentaje de error de asignación de aproximadamente 90%. Los resultados encontrados apoyan el uso de la asignación de paternidad para verificar la estructura genealógica (paternidad y maternidad) de hatos cuya certeza en el pedigrí es crítica para el mejoramiento genético de su raza, y en donde el sistema de manejo extensivo y empadre múltiple limitan el registro adecuado de la progenie al momento del parto.]]></p></abstract>
<abstract abstract-type="short" xml:lang="en"><p><![CDATA[To assess the implications of parentage assignation on herds-genetic improvement nine microsatellite markers were used in order to structure the genealogy of a multisired Braford herd. All progeny (100%) had satisfactory paternity assignment, conversely the maternity verification analysis showed assignation errors up to 90%. Our results support the use of molecular tools to verify the pedigree structure in those herds with management systems that limit the proper registration of progeny at calving.]]></p></abstract>
<kwd-group>
<kwd lng="es"><![CDATA[Microsatélites]]></kwd>
<kwd lng="es"><![CDATA[prueba de paternidad]]></kwd>
<kwd lng="es"><![CDATA[prueba de maternidad]]></kwd>
<kwd lng="es"><![CDATA[Braford]]></kwd>
<kwd lng="en"><![CDATA[Microsatellites]]></kwd>
<kwd lng="en"><![CDATA[paternity test]]></kwd>
<kwd lng="en"><![CDATA[maternity test]]></kwd>
<kwd lng="en"><![CDATA[Braford]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  <BASEFONT SIZE="3">     <P ALIGN="center"><FONT COLOR="000000" FACE="Verdana"><B>Importancia de la  verificación-asignación de progenitores en sistemas extensivos de pie de cría</B></FONT></P>      <P ALIGN="center"><FONT COLOR="000000" FACE="Verdana"> <B>Importance of parentage verification-assignment in extensive multiple-sired  breeding herds</B> </FONT></P>     <P ALIGN="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Williams Arellano-Vera </B><SUP><B>*1</B></SUP><B>, Ana María Sifuentes-Rincón </B><SUP><B>1</B></SUP><B>, Rogelio Garcidueñas-Piña  </B><SUP><B>2</B></SUP><B> y Gaspar Manuel Parra-Bracamonte </B><SUP><B>1</B></SUP> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> <SUP>*1 </SUP>Laboratorio de Biotecnología Animal, Centro de Biotecnología Genómica,  Instituto Politécnico Nacional. Reynosa,Tamaulipas, México. E-mail:  <a href="mailto:warellano@ipn.mx">warellano@ipn.mx</a>;   <a href="mailto:warellano820506@hotmail.com">warellano820506@hotmail.com</a>.</FONT></P>     <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><SUP> 2 </SUP>Facultad de Medicina Veterinaria y Zootecnia,  Universidad Michoacana de San Nicolás de Hidalgo, Morelia, Michoacán, México. </FONT></P>     <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>RESUMEN</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Se aplicó un panel de nueve marcadores microsatélites para estructurar  la genealogía de un hato de ganado Braford manejado bajo empadre múltiple  y destinado a pié de cría, para evaluar las repercusiones de la adecuada  asignación de progenitores, así como las implicaciones en su mejoramiento  genético. Se logró la asignación de paternidad en el 100% de la progenie,  mientras que en los ensayos de verificación de maternidad se estimó un  porcentaje de error de asignación de aproximadamente 90%. Los resultados  encontrados apoyan el uso de la asignación de paternidad para verificar  la estructura genealógica (paternidad y maternidad) de hatos cuya certeza  en el pedigrí es crítica para el mejoramiento genético de su raza, y en  donde el sistema de manejo extensivo y empadre múltiple limitan el registro  adecuado de la progenie al momento del parto. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Palabras clave:</B> Microsatélites, prueba de paternidad, prueba de maternidad, Braford. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>ABSTRACT</B> </FONT></P>      ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">To assess the implications of parentage assignation on herds-genetic improvement  nine microsatellite markers were used in order to structure the genealogy  of a multisired Braford herd. All progeny (100%) had satisfactory paternity  assignment, conversely the maternity verification analysis showed assignation  errors up to 90%. Our results support the use of molecular tools to verify  the pedigree structure in those herds with management systems that limit  the proper registration of progeny at calving. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> <B>Key words:</B> Microsatellites, paternity test, maternity test, Braford.</FONT></P>     <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> Recibido: 11 / 09 / 2008.  Aceptado: 10 / 03 / 2009. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>INTRODUCCIÓN</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">En México, la ganadería bovina (<I>Bos taurus-indicus</I>) destinada a la producción  de carne es la actividad productiva más arraigada en el medio rural y se  realiza, sin excepción, en todas las regiones agroecológicas del país [19].  Esta actividad, tradicionalmente era, y en algunos casos sigue siendo,  concebida como un negocio familiar, cuya administración descansa en decisiones  transmitidas como legado a través de generaciones; por lo que los criterios  para el manejo del hato no son, en la mayoría de los casos, los más adecuados  para su mejoramiento genético. Una de las prácticas más comunes está relacionada  con los criterios subjetivos de selección y asignación de progenitores. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">En las últimas décadas, el uso de metodologías objetivas de estimación  de valores de cría basadas en las evaluaciones genéticas bajo el modelo  animal se han vuelto populares; sin embargo, su empleo requiere la organización  de bases de datos con una estructura de información completa y confiable  que incluya, tanto datos productivos como de pedigrí, asegurando el uso  de valores genéticos precisos. Los errores en el registro de paternidad,  no son privativos de la ganadería mexicana, problema presente aún en países  con sistemas de identificación más completos y complejos, sobre todo en  aquellos en los que sus sistemas productivos están basados en gran medida  en la cría extensiva de ganado bovino [5, 33, 35]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">El registro adecuado del pedigrí, a menudo es restringido por los lugares  de manejo y de crianza de las poblaciones (por ejemplo: la formación de  grupos contemporáneos de hembras a parir, asignadas a salas de parto compartidas  y asignación de progenitores de acuerdo a la observación por cercanía de  la cría a la madre) [10]. Las prácticas reproductivas como el empadre múltiple,  hacen necesario que los animales, producto de este sistema de apareamiento,  deban someterse a pruebas de verificación para obtener predicciones confiables  sobre su valor genético, así como para determinar su efecto sobre el mejoramiento  genético del hato, ya que, si existe una cantidad importante de posibles  progenitores se reduce la precisión en las estimaciones de los valores  genéticos [35]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Debe considerarse además, que las características usadas como criterios  de selección son afectadas no solamente por el genotipo del animal (efecto  directo), sino también por la madre (efecto materno), particularmente aquéllas  medidas en el periodo pre-destete [3, 12, 14, 23]. Actualmente, las tecnologías  basadas en el ADN permiten la asignación/verificación de progenitores.  Esta identificación biológica se basa en el uso de marcadores moleculares  (principalmente los microsatélites) y actualmente es la herramienta por  elección para la identificación y establecimiento de las relaciones genealógicas  entre individuos [1, 4, 13, 33, 36]. El objetivo del presente estudio fue  estructurar la genealogía de un hato de ganado Braford manejado bajo empadre  múltiple, así como la evaluación de las implicaciones de la incorrecta  asignación de paternidad sobre el mejoramiento genético del hato. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>MATERIALES Y MÉTODOS</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Se tomaron muestras de sangre de bovinos de raza Braford (12 padres candidatos,  33 crías y 33 madres), pertenecientes a un rancho productor de pie de cría  ubicado en el municipio de San Juan de Sabinas, Coahuila, México. El manejo  reproductivo de este rancho está basado en el empadre múltiple y el registro  de progenitores periódicamente, de acuerdo a la observación por cercanía  a la madre y fenotipo de los sementales dentro del empadre. </FONT></P>      ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">El aislamiento de ADN se realizó utilizando el estuche comercial Promega  Wizard<SUP>(R)</SUP> (DNA Purification System). La genotipificación se llevó a cabo  utilizando un panel de nueve marcadores microsatélites (<a href="#tab1">TABLA I</a>), los cuales  fueron seleccionados de un panel de 19 <I>loci</I> recomendados por la Organización  para la Agricultura y la Alimentación (FAO) [11], tomando como criterio  de inclusión los rangos alélicos y el contenido de información polimórfica  (PIC). Los microsatélites fueron amplificados mediante la reacción en cadena  de la polimerasa (PCR), evaluando un <I>locus</I> por reacción, en un volumen  final de 10µL. Para determinar los tamaños alélicos, los productos de PCR  se separaron en geles de poliacrilamida-bisacrilamida desnaturalizante  al 6,5%.</FONT></P>     <P ALIGN="CENTER"><b><FONT COLOR="000000" FACE="Verdana" SIZE="2"> <a name="tab1">TABLA I</a></FONT></b></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>SECUENCIA DE INICIADORES PARA AMPLIFICAR LOS 9 </B><I><B>LOCI</B></I><B> MICROSATÉLITES  EN LA RAZA BRAFORD /PRIMER SEQUENCE FOR AMPLIFICATION OF 9 MICROSATELLITE  LOCI IN BRAFORD BREED.</B> </FONT></P>      <div align="center">  <TABLE id="table1" cellspacing="1" width="579" border="1"> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><I>Locus</I> </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Cromosoma </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Secuencia (5´-3´) </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Referencia </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D2S26 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">GCTGCCTTCTACCAAATACCC </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> CTTCCTGAGAGAAGCAACACC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 4 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">HEL5 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">21 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">GCAGGATCACTTGTTAGGGA </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> AGACGTTAGTGTACATTAAC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 5 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA23 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">3 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">GAGTAGAGCTACAAGATAAACTTC</FONT></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TAACTACAGGGTGTTAGATGAACTC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">7 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA037 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">10 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">GATCCTGCTTATATTTAACCAC </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> AAAATTCCATGGAGAGAGAAAC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 7 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA53 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">16 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">GCTTTCAGAAATAGTTTGCATTCA</FONT></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">ATCTTCACATGATATTACAGCAGA </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 8 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D15 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">15 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">AAAGTGACACAACAGCTTCTCCAG</FONT></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">AACGAGTGTCCTAGTTTGGCTGTG </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">11 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA126 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">20 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">CTAATTTAGAATGAGAGAGGCTTCT </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> TTGGTCTCTATTCTCTGAATATTCC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 2, 8 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA040 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGAAAGGGGGTGTGTGGG </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> CTGCCCTGGGGATGATT </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 7 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">BM6444 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">CTCTGGGTACAACACTGAGTCC </FONT></P>      <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> TAGAGAGTTTCCCTGTCCATCC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2, 3 </FONT></P>  </TD> </TR> </TABLE> </div>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><SUP>1</SUP> Stone y col., 1995; <SUP>2 </SUP>Ihara y col., 2004; <SUP>3 </SUP>Bishop y col., 1994; <SUP>4</SUP> Sunden  y col., 1993; <SUP>5 </SUP>Kaukinen y col., 1993; <SUP>6</SUP> Brezinsky y col., 1993; <SUP>7 </SUP>Vaiman  y col., 1994; <SUP>8 </SUP>Georges and Massey, 1992; <SUP>9 </SUP>Sonstegard y col., 1997; <SUP>10  </SUP>Buchanan and Crawford, 1993; <SUP>11</SUP> Moore and Byrne, 1993; <SUP>12</SUP> Steffen y col.,  1993; <SUP>13</SUP> Swarbrick y col., 1991.</FONT></P>     <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Los productos de amplificación fueron analizados en un secuenciador semiautomático  LICOR (Modelo 42001G, LI-COR, Inc, Lincoln, Nebraska, EUA). Con el programa  computacional SAGA GT<SUP>TM</SUP> se obtuvo el tamaño y número de alelos. Mediante  el programa CERVUS, versión 3.0.3, se estimó el número de alelos por <I>locus </I>en los <I>loci seleccionados</I>, su valor medio, la heterocigosidad esperada  (He), heterocigosidad observada (Ho) en cada <I>locus, el </I>valor de contenido  de información polimórfica (PIC) en cada <I>locus </I>y su valor medio. Además  se estimaron las probabilidades de exclusión de paternidad con la ausencia  del genotipo de uno de los padres (PE1) y la probabilidad de exclusión  de paternidad (PE2) para cada <I>locus</I>, usando el programa <I>CERVUS</I>, versión  3.0.3 [17, 20]. Se calculó la probabilidad combinada de exclusión para  los 9 <I>loci </I>(PEC2), donde: <I>P</I>= 1-(1-P<SUB>1</SUB>) (1-<I>P</I><SUB><I>2</I></SUB>) (1-<I>P</I><SUB><I>3</I></SUB>)... (1-<I>P</I><SUB><I>K</I></SUB>), donde: <I>P</I>=  probabilidad combinada de exclusión de paternidad del panel de <I>loci</I> utilizados,  y <I>K</I>= número total de <I>loci</I> dentro del panel utilizado [16]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Asignación y simulación de paternidad/maternidad</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Con la información de la genotipificación de los animales muestreados se  realizaron las pruebas de asignación de maternidad y paternidad en el programa <I>CERVUS</I>, versión 3.0.3, usando criterios de restricción estrictos de 80  y 95% de confianza [17, 20]. Para la asignación de paternidad se formaron  dos grupos de crías, tomando como base el grupo genético de los padres  candidatos. Grupo 1: se formó con 16 crías y 7 posibles padres de raza  Hereford, Grupo 2: se formó de 17 crías y 5 posibles padres de raza Brahman.  </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Análisis del efecto de la asignación de paternidad sobre los parámetros  y valores genéticos</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Se diseñó una prueba para analizar el efecto de la paternidad incierta  sobre los parámetros genéticos: varianza genética directa (&#963;2<SUB>g</SUB>), varianza  ambiental (&#963;<SUP>2</SUP><SUB>e</SUB>), índice de herencia directa (h<SUP>2</SUP><SUB>d</SUB>), proporción de la varianza  ambiental con respecto a la fenotípica (e<SUP>2</SUP>), así como sobre los valores  genéticos (diferencias esperadas en la progenie, DEPs) y sus exactitudes.  Para ello, se ajustó un modelo animal univariado para el peso al nacimiento  (PN), ya que además de la fecha de nacimiento, éste fue el único carácter  del cual se logró obtener datos. Se generaron dos bases de datos: en la  primera (PS) se simuló una paternidad de las crías entre los padres candidatos,  mientras que en la otra se incluyeron los datos de paternidad obtenidos  del análisis de asignación (PR). </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> La simulación de sementales se realizó de manera aleatoria entre los diferentes  padres candidatos utilizados durante el empadre múltiple [34]. El modelo  animal univariado ajustado, incluyó el efecto fijo del sexo de la cría,  el efecto aleatorio del padre y el residual. La forma matricial del modelo  fue: <I>y </I>= ×<I>b </I>+ Æu<I> </I>+ </FONT> <FONT COLOR="000000" SIZE="2" FACE="Symbol"> e</FONT><FONT COLOR="000000" SIZE="2" FACE="Verdana">, Donde: <I>y </I>representa la variable de interés PN; X  y Z, las matrices conocidas de incidencia que relacionan las observaciones  con su respectivo efecto fijo y aleatorio; <I>b, </I>el<I> </I>efecto fijo de sexo de  la cría; <I>u,</I> el efecto aleatorio del padre y </FONT> <FONT COLOR="000000" SIZE="2" FACE="Symbol"> e</FONT><FONT COLOR="000000" SIZE="2" FACE="Verdana">, el efecto residual. Los  componentes de varianza fueron estimados mediante el procedimiento de máxima  verosimilitud restringida usando el programa MTDFREML [2], el índice de  herencia fue estimado por el mismo programa, mediante las salidas de los  componentes de varianza (h<SUP>2</SUP><SUB>d</SUB>=&#963;<SUP>2</SUP><SUB>g</SUB>/&#963;<SUP>2</SUP><SUB>f</SUB>, Donde: h<SUP>2</SUP><SUB>d </SUB>= índice de herencia directa,  &#963;<SUP>2</SUP><SUB>g</SUB>= varianza genética directa, &#963;<SUP>2</SUP><SUB>f</SUB>= varianza fenotípica), las DEPs y exactitudes  fueron obtenidas de una de las subrutinas del subprograma MTDFREML, incluida  en el mismo programa. El criterio de convergencia del modelo fue considerado  en 1 x 10<SUP>–9</SUP>, y se realizaron tres reinicios en el análisis, hasta que el  cambio en el logaritmo de la función de verosimilitud fue menor a 1 x 10<SUP>–4</SUP>,  para asegurar el mínimo global. </FONT></P>      ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>RESULTADOS Y DISCUSIÓN</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Parámetros de diversidad alélica de los </B><I><B>loci</B></I><B> evaluados</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Con los nueve <I>loci</I>, se analizó la población total para obtener su polimorfismo  y sus frecuencias, con lo cual se determinaron los parámetros que se muestran  en la <a href="#tab2">TABLA II</a>.<B> </B>Encontrándose que los <I>loci</I> evaluados muestran mayor variabilidad  genética, comparada con resultados observados en otras razas de bovinos  [6, 8, 15, 21, 29, 31, 33]; esto puede ser atribuido a la variabilidad  intrínseca de la población estudiada ya que el ganado Braford es una raza  derivada del cruzamiento entre animales de raza Brahman y Hereford.</FONT></P>     <P ALIGN="CENTER"><b><FONT COLOR="000000" FACE="Verdana" SIZE="2"> <a name="tab2">TABLA II</a> </FONT> </b></P>      <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>PARÁMETROS DE DIVERSIDAD DE LOS MICROSATÉLITES UTILIZADOS EN LA RAZA BRAFORD/ MICROSATELLITE PARAMETER DIVERSITY IN BRAFORD BREED</B>. </FONT></P>      <div align="center"> <TABLE id="table2" cellspacing="1" width="579" border="1"> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><I>Locus</I></FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Microsatélite </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">No. de alelos </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Rango alélico (pb) </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Ho </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">He </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">PIC </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">PE2 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">BM6444 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">8 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">145-159 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5604 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6661 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6109 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA040 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">22 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">120-204 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8556 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9401 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9310 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA23 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">10 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">195-213 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8000 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8534 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8323 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D15 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">11 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">235-257 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8022 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8855 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8690 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D2S26 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">14 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">114-149 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6098 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8245 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7999 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA126 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">11 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">114-139 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8315 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8324 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8074 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4931 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA53 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">13 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">149-175 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4205 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8399 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8159 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5102 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA037 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">12 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">120-146 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">06932 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8186 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7939 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4733 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">HEL5 </FONT></P>  </TD> <TD VALIGN="TOP" width="66">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">11 </FONT></P>  </TD> <TD VALIGN="TOP" width="110">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">155-179 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6087 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8485 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8252 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5252 </FONT></P>  </TD> </TR> </TABLE> </div>     <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> pb: pares de bases, Ho: heterocigosidad observada, He: heterocigosidad  esperada, PIC: contenido de información polimórfica, PE2: probabilidad  de exclusión de paternidad para cada <I>locus.</I></FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Este hecho muestra claramente la necesidad de caracterizar paneles específicos  de <I>loci</I> para cada raza en la que se pretenda realizar pruebas de paternidad,  ya que el número de alelos y las frecuencias alélicas pueden ser heterogéneos  en diferentes poblaciones de una raza. Una vez determinada la diversidad  genética de los <I>loci</I> microsatélites se procedió a calcular la probabilidad  combinada de exclusión para los 9 <I>loci </I>(PEC2), obtenida mediante el programa  <I>CERVUS</I> (versión 3,0) asumiendo un 96% de <I>loci</I> tipificados y un error del  1% en la genotipificación. La <a href="#tab3">TABLA III</a> muestra la probabilidad combinada  de exclusión para el panel de microsatélites. Los resultados obtenidos  para PIC, He, Ho y PE2, muestran que el <I>locus</I> con mayor variabilidad genética  dentro del estudio fue el INRA040, seguido por el D15.</FONT></P>     <P ALIGN="CENTER"><b><FONT COLOR="000000" SIZE="2" FACE="Verdana"> <a name="tab3">TABLA III </a> </FONT></b></P>     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> <B>PROBABILIDAD DE EXCLUSIÓN COMBINADA DEL PANEL DE </B><I><B>LOCUS</B></I><B> UTILIZADO  PARA LA ASIGNACIÓN DE PATERNIDAD/ COMBINED EXCLUSION PROBABILITY FOR THE  LOCUS PANEL USED IN THE PATERNITY ASSIGNAMENT.</B> </FONT></P>      <div align="center">  <TABLE id="table3" cellspacing="1" width="579" border="1"> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><I>Locus </I>Microsatélite </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">1* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 2* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 3* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 4* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 5* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 6* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 7* </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 8* </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 9* </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">BM6444 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA040 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,7665 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA23 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5373 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D15 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6104 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">D2S26 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4838 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA126 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4931 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4931 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4931 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4931 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">TGLA53 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5102 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5102 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5102 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">INRA037 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4733 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,4733 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">HEL5 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5252 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">PEC2** </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2463 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,8240 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9185 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9682 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9836 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9916 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9959 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9978 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,9989 </FONT></P>  </TD> </TR> </TABLE> </div>     <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">*: Número de <I>loci</I>, PEC2 **: Probabilidad de Exclusión Combinada.</FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Por su parte, el <I>locus</I> BM6444 fue el menos informativo de los 9 seleccionados,  por lo tanto si se excluye a dicho <I>locus</I> del panel se obtendría una probabilidad  de exclusión combinada empleando estos 8 loci de 0.9986, valor aceptable  para la asignación/verificación de relaciones de parentesco [7, 15, 27,  29, 31]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>Verificación/Asignación de Progenitores</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">En el análisis de asignación de paternidad se logró asignar el 100% de  las crías, demostrando la eficiencia del panel de <I>loci</I> microsatélites utilizado.  La asignación de paternidad para las crías de ambos grupos se muestra en  la <a href="#tab4">TABLA IV</a>. Es importante mencionar que las condiciones de manejo reproductivo  son condicionantes de esta falta de certeza en la paternidad de los sementales  dentro del grupo de empadre. Al analizar un hato de ganado Charolais bajo  condiciones similares a las presentes, se ha sugerido [34] que la dominancia  reproductiva puede ser un factor determinante en hatos bajo empadre múltiple.  En Israel se han reportado tasas de identificación errónea del 5% en ganado  lechero teniendo como base reproductiva la inseminación artificial [27],  lo cual indica que este problema no es exclusivo de los sistemas de producción  extensivos. Por otro lado, en este estudio se encontró que solamente el  9% (3 de 33) de las madres “putativas” estaban asignadas correctamente,  obteniéndose por lo tanto un error de asignación de maternidad de 91%.  Los reportes sobre esta circunstancia no son frecuentes, sobre todo en  sistemas de producción con manejo reproductivo basado en inseminación artificial  como los de ganado lechero [10].</FONT></P>     <P ALIGN="center"><b><FONT COLOR="000000" FACE="Verdana" SIZE="2"> <a name="tab4">TABLA IV</a></FONT></b></P>     <P ALIGN="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>ASIGNACIÓN DE PATERNIDAD A LAS CRÍAS DEL GRUPO 1 Y 2/ PATERNITY  ASSIGNAMENT OF GROUP 1 AND 2 OFFSPRING.</B></FONT></P>     <div align="center"> <TABLE id="table4" cellspacing="1" width="575" border="1"> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Grupo de Crías </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">No. de Padre asignado </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Número de Cría </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Grupo 1 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">431 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">188, 150, 147, 195, 190, 186, 157, 156H </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">953 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">143, 158 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">447 </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">177, 156M, 161, 197, </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">453 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">159M, 176 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">917 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">155 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Grupo 2 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> 188279 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">171, 175, 169, 173 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">01/8 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">154, 179, 183, 178, 164, </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">064 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">184, 174, 165, 163, 185, 168 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER">&nbsp;</P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">168 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">159H </FONT></P>  </TD> </TR> </TABLE> </div>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">H: hembra, M: macho.</FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">En términos económicos, el número de vacas totales en la ganadería es quizás  la limitante más importante para la genotipificación del hato reproductivo  [37]. Es importante considerar las implicaciones prácticas y sobre todo  económicas que puede representar la asignación errónea de ambos progenitores,  condición que cobra mayor relevancia al considerar al presente hato como  modelo de pié de cría, cuyos animales son diseminados de manera nacional  o, en su defecto, regional. Se han indicado [37] dos necesidades que motivan  las pruebas de ADN (verificación/asignación) para hatos ganaderos: 1. El  rastreo de la herencia de algún gen o característica indeseable, y 2. Reestructurar  el pedigrí para el mejoramiento genético de hatos en los cuales se registra  la información fenotípica para generar DEPs mediante evaluaciones genéticas. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Las evaluaciones genéticas se han generalizado en México para un gran número  de razas cárnicas como Tropicarne [9], Simmental [28], Charolais [30] y  Brahman [25], entre otras, cuyas asociaciones han logrado organizar grandes  bases de datos genealógicos con el registro de caracteres productivos,  principalmente de crecimiento. Estas evaluaciones usan primordialmente  el modelo animal como metodología para estimar los valores genéticos del  componente directo (paterno), materno, la correlación genética entre ambos  y de ambiente permanente [10]. En este sentido, la certeza en la conformación  del pedigrí asegura la confiabilidad de los estimadores genéticos incluidos  en el modelo de evaluación. Se ha documentado ampliamente, por ejemplo,  que para las variables de peso al nacimiento, al destete y ganancia de  peso predestete, se presenta un fenómeno de covarianza genética negativa  entre efectos genéticos directos y maternos [18, 24, 30], este fenómeno  no es biológicamente posible puesto que la evidencia indica que existe  una fuerte relación entre la producción de leche de la madre y el crecimiento  predestete de sus crías [22]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> La explicación puede encontrarse en la estructura del pedigrí, debido a  que en la estimación del efecto directo es posible contar solamente con  la información de un solo animal, mientras que los efectos maternos dependen  del número de progenie por vaca, del número de vacas con registro de comportamiento  productivo y del número de generaciones en los datos registrados [22].  La identificación errónea de los progenitores conduce a un incremento considerable  en los estimadores de correlación genética entre los efectos directos y  maternos lo que puede sesgar severamente la estimación de los parámetros  y valores genéticos [32]. Más que la complejidad de los modelos de evaluación,  la estructura del pedigrí es fundamental para asegurar la confiabilidad  y la magnitud de la ganancia genética [10]. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> Para visualizar lo anterior, el ensayo de simulación del presente estudio,  similar a otros resultados [34], mostró cambios en los estimadores de varianzas  y parámetros genéticos cuantificados a partir del análisis de dos bases  de datos (Paternidad real y Paternidad simulada). Se observa que al simular  una paternidad se puede subestimar la varianza genética directa [1, 26]  y consecuentemente, el índice de herencia (0,07 estimado a partir de la  paternidad simulada vs. 0,14 estimado a partir de la paternidad real),  así como causar un incremento en las varianzas fenotípica y ambiental (<a href="#tab5">TABLA  V</a>).</FONT></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><b> <a name="tab5">TABLA V</a></b></FONT></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><b>ESTIMADORES GENÉTICOS DE PATERNIDAD SIMULADA Y REAL/ GENETIC PARAMETERS  OF SIMULATED AND TRUE PATERNITY. </b></FONT></P>      <div align="center">  <TABLE id="table5" cellspacing="1" width="570" border="1"> <TR> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Estimador genético </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Paternidad simulada </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Paternidad real </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Logaritmo de verosimilitud -2 log L </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">155,6394 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">127,3615 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Varianza genética directa s<SUP>2</SUP><SUB>d</SUB> </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">1,5609 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">2,7740 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Varianza ambiental s<SUP>2</SUP><SUB>e</SUB> </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">20,6779 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">17,3512 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Varianza fenotípica s<SUP>2</SUP><SUB>f</SUB> </FONT></P>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">22,2388 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">20,1252 </FONT></P>  </TD> </TR> <TR> <TD VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Índice de herencia directa h<SUP>2</SUP><SUB>d</SUB> </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,07 </FONT></P>  </TD> <TD VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,14 </FONT></P>  </TD> </TR> </TABLE> </div>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Estos resultados son consecuencia, sobre todo, del cambio en la clasificación  que el modelo animal realiza con base a la matriz de relaciones de parentesco.  El efecto negativo que tiene la identificación errónea de parentesco sobre  la estimación de parámetros y valores genéticos ha sido puntualizada previamente  [35, 36]. Este trabajo concuerda con otros [10, 36] en el sentido que la  jerarquización de los valores cambia sustancialmente (<a href="#tab6">TABLA VI</a>) cuando  se conoce o no el padre de una cría. Por ejemplo, el semental 447 en la  paternidad simulada muestra una DEP de -0,2601 y en la paternidad real  de 0,5791; en contraste, el semental 431 tiene un valor de DEP en la paternidad  real de -0,1363 y en la paternidad simulada de 0,6664, mostrando una sobreestimación  del valor genético.</FONT></P>     <P ALIGN="CENTER"><b><FONT COLOR="000000" FACE="Verdana" SIZE="2"> <a name="tab6">TABLA VI</a></FONT></b></P>     <P ALIGN="CENTER"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>DIFERENCIAS EN LA PREDICCIÓN DE LOS VALORES GENÉTICOS (DEPs) Y  SUS EXACTITUDES DADA LA PATERNIDAD SIMULADA Y REAL PARA PESO AL NACIMIENTO/  DIFFERENCES AND ACCURACIES OF PREDICTED BREEDING VALUES (DEPs)&nbsp; IN SIMULATED  AND TRUE PATERNITY FOR BIRTH WEIGHT.</B> </FONT></P>      <div align="center">  <TABLE id="table6" cellspacing="1" width="579" border="1"> <TR> <TD VALIGN="TOP" COLSPAN="3">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Paternidad Simulada </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Paternidad Real </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">No. Semental </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">*DEPs/PN </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Exactitud </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">No. Semental </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">DEPs/PN </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Exactitud </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">447 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,2601 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,17 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">447 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,5791 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,30 </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">227 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,2400 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,28 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">431 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,1363 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,34 </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">431 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,6664 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,27 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">917 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,2410 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,18 </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">917 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,0551 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,30 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">453 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,1335 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,23 </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">409 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,6304 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,31 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">953 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,3353 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,17 </FONT>  </TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">453 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,0554 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,31 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">953 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,0968 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,32 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">168 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,3686 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,25 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">01/8 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,4741 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,22 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">53 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,1927 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,13 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">64 </FONT>  </TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,3356 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,20 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> </TR> <TR> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">188279 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">-0,0373 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center"><FONT COLOR="000000" FACE="Verdana" SIZE="2">0,20 </FONT>  </TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     <p align="center">&nbsp;</TD> <TD VALIGN="TOP">     ]]></body>
<body><![CDATA[<p align="center">&nbsp;</TD> </TR> </TABLE> </div>     <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">*DEPs/PN: Diferencias Esperadas en la Progenie para peso al nacimiento.</FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> Las repercusiones que puede tener la adquisición de un progenitor cuyos  valores genéticos sean sobreestimados debido a la asignación errónea de  paternidad, puede conducir no sólo a la disminución de la ganancia genética  del hato [32, 34], sino también, a una pérdida económica en la empresa  ganadera. Aunque en el presente estudio no se incluyó el efecto materno  al momento de estimar las DEPs, por circunstancias implícitas del hato  bajo estudio, se puede esperar que con el resultado encontrado en la verificación  de maternidad, hatos con manejo reproductivo similar puedan presentar un  sesgo sobre el valor genético de los animales evaluados. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>CONCLUSIONES E IMPLICACIONES</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Se estableció un panel de nueve <I>loci</I> microsatélites recomendados por FAO/ISAG  que presentan un alto grado de informatividad para la asignación/verificación  de relaciones filiales (maternidad y paternidad) en ganado Braford. En  este estudio se demuestra la necesidad de establecer paneles apropiados  para cada raza que se desee estudiar. Las implicaciones de un error en  la asignación de la paternidad y más aun de la maternidad, cobran relevancia  bajo los supuestos del modelo animal, sobre todo cuando se evalúan genéticamente  características influenciadas por los efectos maternos, como el peso al  destete. La implementación de pruebas de ADN para la verificación/asignación  de paternidades y maternidades deberá evaluarse en términos económicos  para determinar el beneficio costo-efectivo en función de la ganancia genética  de los sistemas de producción bovina de pié de cría bajo manejo extensivo  y empadre múltiple. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2"><B>AGRADECIMIENTO</B> </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" FACE="Verdana" SIZE="2">Los Autores agradecen al Instituto Politécnico Nacional por el soporte  económico mediante el financiamiento del Proyecto SIP 2007-2161. Se agradece  al programa de becas de Movilidad Santander para estancias de investigación. </FONT></P>      <P ALIGN="justify"><FONT COLOR="000000" SIZE="2" FACE="Verdana"> <B>REFERENCIAS BIBLIOGRÁFICAS</B> </FONT></P>      <!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">1. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> ARANGUREN, M.A.J.; ROMAN, B.R.; ISEA, W.; VILLASMIL, Y.; JORDANA, J. Los  microsatélites (STR´s), marcadores moleculares de ADN por excelencia para  programas de conservación: una revisión. <B>Arch. Latinoam. de Prod. Anim</B>,  13:30-42. 2005. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633390&pid=S0798-2259201000010000800001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">2. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> BOLDMAN, K.G.; KRIESE, L.A.; VAN VLECK, L.D.; VAN TASELL, C.P.; KACHMAN,  S.D. A manual for use of MTDFREML, A set of programs to obtain estimates  of variances and covariances [Draft]. USDA, Agric Res Service. Clay Center,  Lincoln. Ne. 120 pp. 1995. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633391&pid=S0798-2259201000010000800002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">3. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> CABRERA, M.E.; GARNERO, A.; del V. LOBO, R.B.; GUNSKI, R.J. Efecto de la  incorporación de la covarianza genética directa –materna en el análisis  de características de crecimiento en la raza Nelore. <B>Livest Res for Rural  Develop</B> 13:3. 2001. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633392&pid=S0798-2259201000010000800003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">4. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> CHENG, H.H.; CRITTENDEN, L.B. Microsatellite markers for genetic mapping  in the chicken.<B> Poult. Sci</B>. 73:539-546. 1994. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633393&pid=S0798-2259201000010000800004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">5. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> CUNNINGHAM, E.P.; MEGHEN, C.M. Biological identification systems: genetic  markers. International Office of Epizootics,<B> Rev. Scientif et Tech</B> 20:491-499.  2001. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633394&pid=S0798-2259201000010000800005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">6. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> CURI, A.; LOPES, R.C. Evaluation of nine microsatellite loci and misidentification  paternity frecuency in a population of Gyr breed bovine. <B>Braz J. Vet. Res.  of Anim. Sci.</B> São Paulo. 3: 129-135. 2002. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633395&pid=S0798-2259201000010000800006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">7. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> De la ROSA, R.F.X. Evaluación de regiones asociadas a ganancia de peso  en el genoma de individuos de la raza Beefmaster. Centro de Biotecnología  Genómica-IPN, Reynosa Tamaulipas México. Tesis de grado. Pp. 35-37. 2003. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633396&pid=S0798-2259201000010000800007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">8. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> DOMÍNGUEZ, V.J.; NÚÑEZ, D. R.; RAMÍREZ, V.R.; RUIZ, F.A. Evaluación genética  de variables de crecimiento en bovinos Tropicarne: Selección de modelos.  <B>Agrocien.</B> 37:323-335. 2003. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633397&pid=S0798-2259201000010000800008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">9. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> DODDS, G.K.; TATE, L.M.; SIZE, A.J. Genetic evaluation using parentage  information from genetic markers. <B>J Anim Sci</B> 83:2271-2279. 2005. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633398&pid=S0798-2259201000010000800009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">10. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> ELER, J.P.; VAN VLECK, L.D,; FERRAZ, J.B.S.; LÔBO, R.B. Estimation of variants  due to direct and maternal effects for growth traits of nelore cattle.  <B>J. Anim. Sci. </B>73:3253-3258. 1995. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633399&pid=S0798-2259201000010000800010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">11. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> FAO/UNEP/IDAD. Secondary guidelines for development of national farm animal  genetic resources management plans. <B>Measurement of Domestic Animal Diversity:</B>  <B>recommended microsatellite markers</B>. FAO. Rome. 215 pp. 1998. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633400&pid=S0798-2259201000010000800011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">12. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> GEORGES, M.; NIELSEN, D.; MACKINNON, M.; MISHRA, A.; OKIMOTO, R.; PASQINO,  A.T.; SARGEANT, L.S.; SORENSEN, A.; STEELE, M.R.; ZHAO, Y.; WOMACK, J.E.;  HOESCHLE, J. Mapping quantitative trait loci controlling milk production  in dairy cattle exploiting progeny testing. <B>Genet. Soc. of Amer</B>. 139:907-920.  1995. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633401&pid=S0798-2259201000010000800012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">13. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> GÓMEZ, R.L.; PRIEST, K.; RAUW, M.W.; OKOMO, A.M.; THAIN, D.; BRUCE, B.;  RINK, A.; TORELL, R.; GRELLMAN, L.; NARAYANAN, R.; BEATTIE, W.C. The value  of DNA paternity identification in beef cattle: Examples from Nevada´s  free-range ranches. <B>J. Anim. Sci.</B> 86:1724. 2008. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633402&pid=S0798-2259201000010000800013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><span style="font-size: 10.0pt; font-family: Verdana">14. <span style="color:black">GUNSKI, R.J.; GARNERO, A. del V.; REYES, A.B.; BEZERRA,  L.A.F.; LÔBO, R.B.<b> </b>Estimativas de parâmetros genéticos para  características incluidas em critérios de seleção em gado Nelore. <b>Ciên Rural. </b>4: 603-607. 2001.</span></span><FONT COLOR="000000" SIZE="2" FACE="Verdana"> </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633403&pid=S0798-2259201000010000800014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">15. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> HEYEN, W.D.; BECVER E.J.; DA, Y.; EVERT, E.R.; GREEN, C.; BATES, E.R.S.;  ZIEGLE, S.J.; LEWIN, A.H. Exclusion probabilities of 22 bovine microsatellite  markers in fluorescent multiplexes for semiautomated parentage testing.  <B>Anim. Genet</B>. 28:21-27. 1997. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633404&pid=S0798-2259201000010000800015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">16. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> JAIMENSON, A.; TAYLOR, S.T.C.S. Comparison of three probability formulae  for parentage exclusion. <B>Anim. Genet.</B> 28:397-400. 1997. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633405&pid=S0798-2259201000010000800016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">17. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> KALINOWSKI, T.S.; TAPER, L.M.; MARSHALL, C.T. Revising how the computer  program cervus accommodates genotyping error increases in paternity assignment.  <B>Mol. Ecol</B>. 16:1099-1106. 2007. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633406&pid=S0798-2259201000010000800017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">18. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> KOOTS, K.R.; GIBSON, P.J.; SMITH, C.; WILTON, W.J. Analysis of published  genetic parameter estimates for beef production traits, 1. Heritability.  <B>Anim. Breed Abs.</B> 62:309-338. 1994. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633407&pid=S0798-2259201000010000800018&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">19. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> LASTRA, M.I.J.; PERALTA, A.M.A. La producción de carnes en México y sus  perspectivas 1990-2000. Secretaria de Agricultura Ganadería, Desarrollo  Rural, Pesca y Alimentación. En Línea: <a href="http://www.sagar.gob.mx">http://www.sagar.gob.mx</a>.  01-18-07 </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633408&pid=S0798-2259201000010000800019&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">20. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> MARSHALL, T.C. CERVUS 3.0. General release version-24 April 2001. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633409&pid=S0798-2259201000010000800020&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">21. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> MARTÍNEZ, M.A.; CALDERÓN, J.; CAMACHO, E.; RICO, C.; VEGA, P.L.J.; DELGADO,  V.J. Caracterización genética de la raza bovina Mostrenca con microsatélites.  <B>Arch. de Zoot.</B> 54:357-361. 2005. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633410&pid=S0798-2259201000010000800021&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">22. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> MANIATIS, N.; POLLOT, E.G. The impact of data structure on genetic (co)variance  components of early growth in sheep, estimated using an animal model with  maternal effects. <B>J. Anim. Sci</B>. 81:101-108. 2003. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633411&pid=S0798-2259201000010000800022&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">23. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> MERCADANTE, M.E.Z.; LÔBO, R.B. Estimativas de (Co) variancias e parâmetros  genéticos dos efeitos direto e materno de características de crescimento  de fêmeas de um rebanho nelore. <B>Rev. Bras. Zoot.</B> 26:1124-1133. 1997. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633412&pid=S0798-2259201000010000800023&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">24. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> MOHIUDDIN, G. Estimates of genetic and phenotypic parameters of some performance  traits in beef cattle. <B>Anim. Breed Abstr.</B> 61:495-522. 1993. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633413&pid=S0798-2259201000010000800024&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">25. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> PARRA, B.G.M.; MARTÍNEZ, G.J.C.; CIENFUEGOS, R.E.G.; GARCÍA, E.F.J.; ORTEGA, R.E. Parámetros genéticos de variables de crecimiento de ganado Brahman  de registro en México. <B>Vet. Méx.</B> 38:217-229. 2007. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633414&pid=S0798-2259201000010000800025&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">26. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> QUINTERO, J.C.; TRIANA, J.G.; QUIJANO, J.H.; ARBOLEDA, E. Influencia de  la inclusión del efecto materno en la estimación de parámetros genéticos  del peso al destete en un hato de ganado de carne. <B>Rev. Col. Cien. Pec.</B>  20:117-123. 2007. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633415&pid=S0798-2259201000010000800026&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">27. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> RON, M.; BLANC, M.; EZRA, E.; WELLER, J.I. Misidentification rate in the  Israeli dairy cattle population and its implications for genetic improvement.  <B>J. Dairy Sci. </B>79:676-681. 1996. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633416&pid=S0798-2259201000010000800027&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">28. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> ROSALES, A.J.; ELZO, A.M.; MONTAÑO, B.M.; VEGA, M.M.V. Parámetros y tendencias  genéticas para características de crecimiento predestete en la población  mexicana de Simmental. <B>Rev. Téc. Pec. en Méx.</B> 42:171-181. 2004. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633417&pid=S0798-2259201000010000800028&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">29. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> RIOJAS, V.V.M.; GOMEZ, F.J.C.; SALINAS, M.J.A.; MONTES, de O.L.R.; WONG,  G.A. Confiabilidad del análisis de ADN en pruebas de paternidad para bovinos  Brahman y Brangus en México. Universidad Autónoma de Nuevo León. <B>Cien</B>.<B>   </B>9:41-50. 2006. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633418&pid=S0798-2259201000010000800029&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">30. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> RÍOS, U.A.; MARTÍNEZ, V.G.; TSURUTA, S.; BERTRAND, K.J.; VEGA, M.E.V.;  MONTAÑO, B.M. Estimadores de parámetros genéticos para características  de crecimiento de ganado Charolais mexicano. <B>Téc. Pec. en Méx.</B> 45:121-130.  2007. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633419&pid=S0798-2259201000010000800030&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">31. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> SALAZAR, M.E.L. Evaluación de nueve marcadores microsatélites para la genotipificación  de ganado bovino. Centro de Biotecnología Genómica-IPN, Reynosa Tamaulipas  México. Tesis de Grado. 38-42 pp. 2002. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633420&pid=S0798-2259201000010000800031&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">32. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> SENNEKE, S.L.; MACNEIL, M.D.; VAN VLECK, L.D. Effects of sire misidentification  on estimates of genetic parameters for birth and weaning weights in Hereford  cattle. <B>J. of Anim. Sci.</B> 82:2307-2312. 2004. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633421&pid=S0798-2259201000010000800032&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">33. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> SHERMAN, B.G.; KACHMAN, D.S.; HUNGERFORD, L.L.; RUPP, P.G.; FOX, P.C.;  BROWN, D.M.; FEUZ, M.B.; HOLM, R.T. Impact of candidate sire number and  sire relatedness on DNA polymorphism based measures of exclusion probability  and probability of unambiguous parentage. <B>Anim. Genet.</B> 35:220-226. 2004. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633422&pid=S0798-2259201000010000800033&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">34. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> SIFUENTES, R.A.M.; PARRA, B.G.M.; De la ROSA, R.X.F.; SÁNCHEZ, V.A.; SERRANO,  M.F.; ROSALES, A.J. Importancia de las pruebas de paternidad basadas en  microsatélites para la evaluación genética de ganado de carne en empadre  múltiple. <B>Téc. Pec. en Méx.</B> 44:389-398. 2006. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633423&pid=S0798-2259201000010000800034&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">35. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> TOSH, J.J.; WILTON, J.W. Effects of data estructure on variance of prediction  error and accuracy of genetic evaluation. <B>J. of Anim. Sci.</B> 72:2568-2577.  1994. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633424&pid=S0798-2259201000010000800035&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">36. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> VELMALA, R.J.; VILKKI, H.J.; ELO, K.T.; DE KONING, D.J.; MAKI, T.A.V. A  search for quantitative trait loci for milk production traits on chromosome  6 in Finnish Ayrshire cattle. <B>Anim. Genet.</B> 30:136-143. 1999. </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633425&pid=S0798-2259201000010000800036&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><font face="Verdana" size="2">37. </font> <FONT COLOR="000000" SIZE="2" FACE="Verdana"> WEABER, R.L. DNA Parentage Testing. In: <B>Proceedings of Beff Improvement  Federadtion 8th Genetic Prediction Workshop Molecular Approaches to Genetic  Improvement.</B> December 4-6. Kansas City, Missouri. Pp. 53-58. 2003.</FONT><FONT COLOR="333333" FACE="Verdana" SIZE="2"> </FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1633426&pid=S0798-2259201000010000800037&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --> ]]></body>
<back>
<ref-list>
<ref id="B1">
<label>1</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ARANGUREN]]></surname>
<given-names><![CDATA[M.A.J.]]></given-names>
</name>
<name>
<surname><![CDATA[ROMAN]]></surname>
<given-names><![CDATA[B.R.]]></given-names>
</name>
<name>
<surname><![CDATA[ISEA]]></surname>
<given-names><![CDATA[W.]]></given-names>
</name>
<name>
<surname><![CDATA[VILLASMIL]]></surname>
<given-names><![CDATA[Y.]]></given-names>
</name>
<name>
<surname><![CDATA[JORDANA]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Los microsatélites (STR´s), marcadores moleculares de ADN por excelencia para programas de conservación: una revisión]]></article-title>
<source><![CDATA[Arch. Latinoam. de Prod. Anim,]]></source>
<year>2005</year>
<volume>13</volume>
<page-range>30-42</page-range></nlm-citation>
</ref>
<ref id="B2">
<label>2</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[BOLDMAN]]></surname>
<given-names><![CDATA[K.G]]></given-names>
</name>
<name>
<surname><![CDATA[KRIESE]]></surname>
<given-names><![CDATA[L.A]]></given-names>
</name>
<name>
<surname><![CDATA[VAN VLECK]]></surname>
<given-names><![CDATA[L.D]]></given-names>
</name>
<name>
<surname><![CDATA[VAN TASELL]]></surname>
<given-names><![CDATA[C.P]]></given-names>
</name>
<name>
<surname><![CDATA[KACHMAN]]></surname>
<given-names><![CDATA[S.D]]></given-names>
</name>
</person-group>
<source><![CDATA[A manual for use of MTDFREML: A set of programs to obtain estimates of variances and covariances [Draft]]]></source>
<year>1995</year>
<page-range>120</page-range><publisher-name><![CDATA[USDA, Agric Res Service]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B3">
<label>3</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[CABRERA]]></surname>
<given-names><![CDATA[M.E.]]></given-names>
</name>
<name>
<surname><![CDATA[GARNERO]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[del V. LOBO]]></surname>
<given-names><![CDATA[R.B.]]></given-names>
</name>
<name>
<surname><![CDATA[GUNSKI]]></surname>
<given-names><![CDATA[R.J]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Efecto de la incorporación de la covarianza genética directa -materna en el análisis de características de crecimiento en la raza Nelore]]></article-title>
<source><![CDATA[Livest Res for Rural Develop]]></source>
<year>2001</year>
<volume>13</volume>
<page-range>3</page-range></nlm-citation>
</ref>
<ref id="B4">
<label>4</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[CHENG]]></surname>
<given-names><![CDATA[H.H.]]></given-names>
</name>
<name>
<surname><![CDATA[CRITTENDEN]]></surname>
<given-names><![CDATA[L.B]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Microsatellite markers for genetic mapping in the chicken]]></article-title>
<source><![CDATA[Poult. Sci.]]></source>
<year>1994</year>
<volume>73</volume>
<page-range>539-546</page-range></nlm-citation>
</ref>
<ref id="B5">
<label>5</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[CUNNINGHAM]]></surname>
<given-names><![CDATA[E.P.]]></given-names>
</name>
<name>
<surname><![CDATA[MEGHEN]]></surname>
<given-names><![CDATA[C.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Biological identification systems: genetic markers. International Office of Epizootics]]></article-title>
<source><![CDATA[Rev. Scientif et Tech]]></source>
<year>2001</year>
<volume>20</volume>
<page-range>491-499</page-range></nlm-citation>
</ref>
<ref id="B6">
<label>6</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[CURI]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[LOPES]]></surname>
<given-names><![CDATA[R.C]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Evaluation of nine microsatellite loci and misidentification paternity frecuency in a population of Gyr breed bovine]]></article-title>
<source><![CDATA[Braz J. Vet. Res. of Anim. Sci.]]></source>
<year>2002</year>
<volume>3</volume>
<page-range>129-135</page-range><publisher-loc><![CDATA[São Paulo ]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B7">
<label>7</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[De la ROSA]]></surname>
<given-names><![CDATA[R.F.X]]></given-names>
</name>
</person-group>
<source><![CDATA[Evaluación de regiones asociadas a ganancia de peso en el genoma de individuos de la raza Beefmaster]]></source>
<year>2003</year>
<page-range>35-37</page-range><publisher-loc><![CDATA[^eReynosa Tamaulipas Reynosa Tamaulipas]]></publisher-loc>
<publisher-name><![CDATA[Centro de Biotecnología Genómica-IPN]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B8">
<label>8</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[DOMÍNGUEZ]]></surname>
<given-names><![CDATA[V.J.]]></given-names>
</name>
<name>
<surname><![CDATA[NÚÑEZ]]></surname>
<given-names><![CDATA[D. R.]]></given-names>
</name>
<name>
<surname><![CDATA[RAMÍREZ]]></surname>
<given-names><![CDATA[V.R.]]></given-names>
</name>
<name>
<surname><![CDATA[RUIZ]]></surname>
<given-names><![CDATA[F.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Evaluación genética de variables de crecimiento en bovinos Tropicarne: Selección de modelos]]></article-title>
<source><![CDATA[Agrocien.]]></source>
<year>2003</year>
<volume>37</volume>
<page-range>323-335</page-range></nlm-citation>
</ref>
<ref id="B9">
<label>9</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[DODDS]]></surname>
<given-names><![CDATA[G.K.]]></given-names>
</name>
<name>
<surname><![CDATA[TATE]]></surname>
<given-names><![CDATA[L.M.]]></given-names>
</name>
<name>
<surname><![CDATA[SIZE]]></surname>
<given-names><![CDATA[A.J]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genetic evaluation using parentage information from genetic markers]]></article-title>
<source><![CDATA[J Anim Sci]]></source>
<year>2005</year>
<volume>83</volume>
<page-range>2271-2279</page-range></nlm-citation>
</ref>
<ref id="B10">
<label>10</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ELER]]></surname>
<given-names><![CDATA[J.P.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN VLECK]]></surname>
<given-names><![CDATA[L.D,]]></given-names>
</name>
<name>
<surname><![CDATA[FERRAZ]]></surname>
<given-names><![CDATA[J.B.S.]]></given-names>
</name>
<name>
<surname><![CDATA[LÔBO]]></surname>
<given-names><![CDATA[R.B]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Estimation of variants due to direct and maternal effects for growth traits of nelore cattle]]></article-title>
<source><![CDATA[J. Anim. Sci.]]></source>
<year>1995</year>
<volume>73</volume>
<page-range>3253-3258</page-range></nlm-citation>
</ref>
<ref id="B11">
<label>11</label><nlm-citation citation-type="book">
<collab>FAO/UNEP/IDAD</collab>
<source><![CDATA[Secondary guidelines for development of national farm animal genetic resources management plans: Measurement of Domestic Animal Diversity: recommended microsatellite markers]]></source>
<year>1998</year>
<page-range>215</page-range><publisher-loc><![CDATA[Rome ]]></publisher-loc>
<publisher-name><![CDATA[FAO]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B12">
<label>12</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GEORGES]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[NIELSEN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[MACKINNON]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[MISHRA]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[OKIMOTO]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[PASQINO]]></surname>
<given-names><![CDATA[A.T.]]></given-names>
</name>
<name>
<surname><![CDATA[SARGEANT]]></surname>
<given-names><![CDATA[L.S.]]></given-names>
</name>
<name>
<surname><![CDATA[SORENSEN]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[STEELE]]></surname>
<given-names><![CDATA[M.R.]]></given-names>
</name>
<name>
<surname><![CDATA[ZHAO]]></surname>
<given-names><![CDATA[Y.]]></given-names>
</name>
<name>
<surname><![CDATA[WOMACK]]></surname>
<given-names><![CDATA[J.E.]]></given-names>
</name>
<name>
<surname><![CDATA[HOESCHLE]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Mapping quantitative trait loci controlling milk production in dairy cattle exploiting progeny testing]]></article-title>
<source><![CDATA[Genet. Soc. of Amer.]]></source>
<year>1995</year>
<volume>139</volume>
<page-range>907-920</page-range></nlm-citation>
</ref>
<ref id="B13">
<label>13</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GÓMEZ]]></surname>
<given-names><![CDATA[R.L.]]></given-names>
</name>
<name>
<surname><![CDATA[PRIEST]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[RAUW]]></surname>
<given-names><![CDATA[M.W.]]></given-names>
</name>
<name>
<surname><![CDATA[OKOMO]]></surname>
<given-names><![CDATA[A.M.]]></given-names>
</name>
<name>
<surname><![CDATA[THAIN]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[BRUCE]]></surname>
<given-names><![CDATA[B.]]></given-names>
</name>
<name>
<surname><![CDATA[RINK]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[TORELL]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[GRELLMAN]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[NARAYANAN]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[BEATTIE]]></surname>
<given-names><![CDATA[W.C]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The value of DNA paternity identification in beef cattle: Examples from Nevada´s free-range ranches]]></article-title>
<source><![CDATA[J. Anim. Sci.]]></source>
<year>2008</year>
<volume>86</volume>
<page-range>1724</page-range></nlm-citation>
</ref>
<ref id="B14">
<label>14</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[GUNSKI]]></surname>
<given-names><![CDATA[R.J.]]></given-names>
</name>
<name>
<surname><![CDATA[GARNERO]]></surname>
<given-names><![CDATA[A. del V.]]></given-names>
</name>
<name>
<surname><![CDATA[REYES]]></surname>
<given-names><![CDATA[A.B.]]></given-names>
</name>
<name>
<surname><![CDATA[BEZERRA]]></surname>
<given-names><![CDATA[L.A.F.]]></given-names>
</name>
<name>
<surname><![CDATA[LÔBO]]></surname>
<given-names><![CDATA[R.B]]></given-names>
</name>
</person-group>
<article-title xml:lang="pt"><![CDATA[Estimativas de parâmetros genéticos para características incluidas em critérios de seleção em gado Nelore]]></article-title>
<source><![CDATA[Ciên Rural.]]></source>
<year>2001</year>
<volume>4</volume>
<page-range>603-607</page-range></nlm-citation>
</ref>
<ref id="B15">
<label>15</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[HEYEN]]></surname>
<given-names><![CDATA[W.D.]]></given-names>
</name>
<name>
<surname><![CDATA[BECVER E.J.; DA]]></surname>
<given-names><![CDATA[Y.]]></given-names>
</name>
<name>
<surname><![CDATA[EVERT]]></surname>
<given-names><![CDATA[E.R.]]></given-names>
</name>
<name>
<surname><![CDATA[GREEN]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[BATES]]></surname>
<given-names><![CDATA[E.R.S.]]></given-names>
</name>
<name>
<surname><![CDATA[ZIEGLE]]></surname>
<given-names><![CDATA[S.J.]]></given-names>
</name>
<name>
<surname><![CDATA[LEWIN]]></surname>
<given-names><![CDATA[A.H]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Exclusion probabilities of 22 bovine microsatellite markers in fluorescent multiplexes for semiautomated parentage testing]]></article-title>
<source><![CDATA[Anim. Genet.]]></source>
<year>1997</year>
<volume>28</volume>
<page-range>21-27</page-range></nlm-citation>
</ref>
<ref id="B16">
<label>16</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[JAIMENSON]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[TAYLOR]]></surname>
<given-names><![CDATA[S.T.C.S]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Comparison of three probability formulae for parentage exclusion]]></article-title>
<source><![CDATA[Anim. Genet.]]></source>
<year>1997</year>
<volume>28</volume>
<page-range>397-400</page-range></nlm-citation>
</ref>
<ref id="B17">
<label>17</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[KALINOWSKI]]></surname>
<given-names><![CDATA[T.S.]]></given-names>
</name>
<name>
<surname><![CDATA[TAPER]]></surname>
<given-names><![CDATA[L.M.]]></given-names>
</name>
<name>
<surname><![CDATA[MARSHALL]]></surname>
<given-names><![CDATA[C.T]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Revising how the computer program cervus accommodates genotyping error increases in paternity assignment]]></article-title>
<source><![CDATA[Mol. Ecol.]]></source>
<year>2007</year>
<volume>16</volume>
<page-range>1099-1106</page-range></nlm-citation>
</ref>
<ref id="B18">
<label>18</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[KOOTS]]></surname>
<given-names><![CDATA[K.R.]]></given-names>
</name>
<name>
<surname><![CDATA[GIBSON]]></surname>
<given-names><![CDATA[P.J.]]></given-names>
</name>
<name>
<surname><![CDATA[SMITH]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[WILTON]]></surname>
<given-names><![CDATA[W.J]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Analysis of published genetic parameter estimates for beef production traits, 1. Heritability]]></article-title>
<source><![CDATA[Anim. Breed Abs.]]></source>
<year>1994</year>
<volume>62</volume>
<page-range>309-338</page-range></nlm-citation>
</ref>
<ref id="B19">
<label>19</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[LASTRA]]></surname>
<given-names><![CDATA[M.I.J]]></given-names>
</name>
<name>
<surname><![CDATA[PERALTA]]></surname>
<given-names><![CDATA[A.M.A]]></given-names>
</name>
</person-group>
<source><![CDATA[La producción de carnes en México y sus perspectivas 1990-2000]]></source>
<year></year>
<publisher-name><![CDATA[Secretaria de Agricultura Ganadería, Desarrollo Rural, Pesca y Alimentación]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B20">
<label>20</label><nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MARSHALL]]></surname>
<given-names><![CDATA[T.C]]></given-names>
</name>
</person-group>
<source><![CDATA[CERVUS 3.0. General release version-24]]></source>
<year>2001</year>
</nlm-citation>
</ref>
<ref id="B21">
<label>21</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MARTÍNEZ]]></surname>
<given-names><![CDATA[M.A.]]></given-names>
</name>
<name>
<surname><![CDATA[CALDERÓN]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[CAMACHO]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[RICO]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[VEGA]]></surname>
<given-names><![CDATA[P.L.J.]]></given-names>
</name>
<name>
<surname><![CDATA[DELGADO]]></surname>
<given-names><![CDATA[V.J]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Caracterización genética de la raza bovina Mostrenca con microsatélites]]></article-title>
<source><![CDATA[Arch. de Zoot.]]></source>
<year>2005</year>
<volume>54</volume>
<page-range>357-361</page-range></nlm-citation>
</ref>
<ref id="B22">
<label>22</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MANIATIS]]></surname>
<given-names><![CDATA[N.]]></given-names>
</name>
<name>
<surname><![CDATA[POLLOT]]></surname>
<given-names><![CDATA[E.G]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The impact of data structure on genetic (co)variance components of early growth in sheep, estimated using an animal model with maternal effects]]></article-title>
<source><![CDATA[J. Anim. Sci.]]></source>
<year>2003</year>
<volume>81</volume>
<page-range>101-108</page-range></nlm-citation>
</ref>
<ref id="B23">
<label>23</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MERCADANTE]]></surname>
<given-names><![CDATA[M.E.Z.]]></given-names>
</name>
<name>
<surname><![CDATA[LÔBO]]></surname>
<given-names><![CDATA[R.B]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Estimativas de (Co) variancias e parâmetros genéticos dos efeitos direto e materno de características de crescimento de fêmeas de um rebanho nelore]]></article-title>
<source><![CDATA[Rev. Bras. Zoot.]]></source>
<year>1997</year>
<volume>26</volume>
<page-range>1124-1133</page-range></nlm-citation>
</ref>
<ref id="B24">
<label>24</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[MOHIUDDIN]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Estimates of genetic and phenotypic parameters of some performance traits in beef cattle]]></article-title>
<source><![CDATA[Anim. Breed Abstr.]]></source>
<year>1993</year>
<volume>61</volume>
<page-range>495-522</page-range></nlm-citation>
</ref>
<ref id="B25">
<label>25</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[PARRA]]></surname>
<given-names><![CDATA[B.G.M.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTÍNEZ]]></surname>
<given-names><![CDATA[G.J.C.]]></given-names>
</name>
<name>
<surname><![CDATA[CIENFUEGOS]]></surname>
<given-names><![CDATA[R.E.G.]]></given-names>
</name>
<name>
<surname><![CDATA[GARCÍA]]></surname>
<given-names><![CDATA[E.F.J.]]></given-names>
</name>
<name>
<surname><![CDATA[ORTEGA]]></surname>
<given-names><![CDATA[R.E]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Parámetros genéticos de variables de crecimiento de ganado Brahman de registro en México]]></article-title>
<source><![CDATA[Vet. Méx.]]></source>
<year>2007</year>
<volume>38</volume>
<page-range>217-229</page-range></nlm-citation>
</ref>
<ref id="B26">
<label>26</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[QUINTERO]]></surname>
<given-names><![CDATA[J.C.]]></given-names>
</name>
<name>
<surname><![CDATA[TRIANA]]></surname>
<given-names><![CDATA[J.G.]]></given-names>
</name>
<name>
<surname><![CDATA[QUIJANO]]></surname>
<given-names><![CDATA[J.H.]]></given-names>
</name>
<name>
<surname><![CDATA[ARBOLEDA]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Influencia de la inclusión del efecto materno en la estimación de parámetros genéticos del peso al destete en un hato de ganado de carne]]></article-title>
<source><![CDATA[Rev. Col. Cien. Pec.]]></source>
<year>2007</year>
<volume>20</volume>
<page-range>117-123</page-range></nlm-citation>
</ref>
<ref id="B27">
<label>27</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[RON]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[BLANC]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[EZRA]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[WELLER]]></surname>
<given-names><![CDATA[J.I]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Misidentification rate in the Israeli dairy cattle population and its implications for genetic improvement]]></article-title>
<source><![CDATA[J. Dairy Sci.]]></source>
<year>1996</year>
<volume>79</volume>
<page-range>676-681</page-range></nlm-citation>
</ref>
<ref id="B28">
<label>28</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[ROSALES]]></surname>
<given-names><![CDATA[A.J.]]></given-names>
</name>
<name>
<surname><![CDATA[ELZO]]></surname>
<given-names><![CDATA[A.M.]]></given-names>
</name>
<name>
<surname><![CDATA[MONTAÑO]]></surname>
<given-names><![CDATA[B.M.]]></given-names>
</name>
<name>
<surname><![CDATA[VEGA]]></surname>
<given-names><![CDATA[M.M.V]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Parámetros y tendencias genéticas para características de crecimiento predestete en la población mexicana de Simmental]]></article-title>
<source><![CDATA[Rev. Téc. Pec. en Méx.]]></source>
<year>2004</year>
<volume>42</volume>
<page-range>171-181</page-range></nlm-citation>
</ref>
<ref id="B29">
<label>29</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[RIOJAS]]></surname>
<given-names><![CDATA[V.V.M.]]></given-names>
</name>
<name>
<surname><![CDATA[GOMEZ]]></surname>
<given-names><![CDATA[F.J.C.]]></given-names>
</name>
<name>
<surname><![CDATA[SALINAS]]></surname>
<given-names><![CDATA[M.J.A.]]></given-names>
</name>
<name>
<surname><![CDATA[MONTES]]></surname>
<given-names><![CDATA[de O.L.R.]]></given-names>
</name>
<name>
<surname><![CDATA[WONG]]></surname>
<given-names><![CDATA[G.A]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Confiabilidad del análisis de ADN en pruebas de paternidad para bovinos Brahman y Brangus en México]]></article-title>
<source><![CDATA[Cien.]]></source>
<year>2006</year>
<volume>9</volume>
<page-range>41-50</page-range></nlm-citation>
</ref>
<ref id="B30">
<label>30</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[RÍOS]]></surname>
<given-names><![CDATA[U.A.]]></given-names>
</name>
<name>
<surname><![CDATA[MARTÍNEZ]]></surname>
<given-names><![CDATA[V.G.]]></given-names>
</name>
<name>
<surname><![CDATA[TSURUTA]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[BERTRAND]]></surname>
<given-names><![CDATA[K.J.]]></given-names>
</name>
<name>
<surname><![CDATA[VEGA]]></surname>
<given-names><![CDATA[M.E.V.]]></given-names>
</name>
<name>
<surname><![CDATA[MONTAÑO]]></surname>
<given-names><![CDATA[B.M]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Estimadores de parámetros genéticos para características de crecimiento de ganado Charolais mexicano]]></article-title>
<source><![CDATA[Téc. Pec. en Méx.]]></source>
<year>2007</year>
<volume>45</volume>
<page-range>121-130</page-range></nlm-citation>
</ref>
<ref id="B31">
<label>31</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SALAZAR]]></surname>
<given-names><![CDATA[M.E.L]]></given-names>
</name>
</person-group>
<source><![CDATA[Evaluación de nueve marcadores microsatélites para la genotipificación de ganado bovino]]></source>
<year>2002</year>
<page-range>38-42</page-range><publisher-loc><![CDATA[^eReynosa Tamaulipas Reynosa Tamaulipas]]></publisher-loc>
<publisher-name><![CDATA[Centro de Biotecnología Genómica-IPN]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B32">
<label>32</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SENNEKE]]></surname>
<given-names><![CDATA[S.L.]]></given-names>
</name>
<name>
<surname><![CDATA[MACNEIL]]></surname>
<given-names><![CDATA[M.D.]]></given-names>
</name>
<name>
<surname><![CDATA[VAN VLECK]]></surname>
<given-names><![CDATA[L.D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Effects of sire misidentification on estimates of genetic parameters for birth and weaning weights in Hereford cattle]]></article-title>
<source><![CDATA[J. of Anim. Sci.]]></source>
<year>2004</year>
<volume>82</volume>
<page-range>2307-2312</page-range></nlm-citation>
</ref>
<ref id="B33">
<label>33</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SHERMAN]]></surname>
<given-names><![CDATA[B.G.]]></given-names>
</name>
<name>
<surname><![CDATA[KACHMAN]]></surname>
<given-names><![CDATA[D.S.]]></given-names>
</name>
<name>
<surname><![CDATA[HUNGERFORD]]></surname>
<given-names><![CDATA[L.L.]]></given-names>
</name>
<name>
<surname><![CDATA[RUPP]]></surname>
<given-names><![CDATA[P.G.]]></given-names>
</name>
<name>
<surname><![CDATA[FOX]]></surname>
<given-names><![CDATA[P.C.]]></given-names>
</name>
<name>
<surname><![CDATA[BROWN]]></surname>
<given-names><![CDATA[D.M.]]></given-names>
</name>
<name>
<surname><![CDATA[FEUZ]]></surname>
<given-names><![CDATA[M.B.]]></given-names>
</name>
<name>
<surname><![CDATA[HOLM]]></surname>
<given-names><![CDATA[R.T]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Impact of candidate sire number and sire relatedness on DNA polymorphism based measures of exclusion probability and probability of unambiguous parentage]]></article-title>
<source><![CDATA[Anim. Genet.]]></source>
<year>2004</year>
<volume>35</volume>
<page-range>220-226</page-range></nlm-citation>
</ref>
<ref id="B34">
<label>34</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[SIFUENTES]]></surname>
<given-names><![CDATA[R.A.M.]]></given-names>
</name>
<name>
<surname><![CDATA[PARRA]]></surname>
<given-names><![CDATA[B.G.M.]]></given-names>
</name>
<name>
<surname><![CDATA[De la ROSA]]></surname>
<given-names><![CDATA[R.X.F.]]></given-names>
</name>
<name>
<surname><![CDATA[SÁNCHEZ]]></surname>
<given-names><![CDATA[V.A.]]></given-names>
</name>
<name>
<surname><![CDATA[SERRANO]]></surname>
<given-names><![CDATA[M.F.]]></given-names>
</name>
<name>
<surname><![CDATA[ROSALES]]></surname>
<given-names><![CDATA[A.J]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Importancia de las pruebas de paternidad basadas en microsatélites para la evaluación genética de ganado de carne en empadre múltiple]]></article-title>
<source><![CDATA[Téc. Pec. en Méx.]]></source>
<year>2006</year>
<volume>44</volume>
<page-range>389-398</page-range></nlm-citation>
</ref>
<ref id="B35">
<label>35</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[TOSH]]></surname>
<given-names><![CDATA[J.J.]]></given-names>
</name>
<name>
<surname><![CDATA[WILTON]]></surname>
<given-names><![CDATA[J.W]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Effects of data estructure on variance of prediction error and accuracy of genetic evaluation]]></article-title>
<source><![CDATA[J. of Anim. Sci.]]></source>
<year>1994</year>
<volume>72</volume>
<page-range>2568-2577</page-range></nlm-citation>
</ref>
<ref id="B36">
<label>36</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[VELMALA]]></surname>
<given-names><![CDATA[R.J.]]></given-names>
</name>
<name>
<surname><![CDATA[VILKKI]]></surname>
<given-names><![CDATA[H.J.]]></given-names>
</name>
<name>
<surname><![CDATA[ELO]]></surname>
<given-names><![CDATA[K.T.]]></given-names>
</name>
<name>
<surname><![CDATA[DE KONING]]></surname>
<given-names><![CDATA[D.J.]]></given-names>
</name>
<name>
<surname><![CDATA[MAKI]]></surname>
<given-names><![CDATA[T.A.V]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A search for quantitative trait loci for milk production traits on chromosome 6 in Finnish Ayrshire cattle]]></article-title>
<source><![CDATA[Anim. Genet.]]></source>
<year>1999</year>
<volume>30</volume>
<page-range>136-143</page-range></nlm-citation>
</ref>
<ref id="B37">
<label>37</label><nlm-citation citation-type="confpro">
<person-group person-group-type="author">
<name>
<surname><![CDATA[WEABER]]></surname>
<given-names><![CDATA[R.L]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[DNA Parentage Testing]]></article-title>
<source><![CDATA[]]></source>
<year>2003</year>
<conf-name><![CDATA[8th Genetic Prediction Workshop Molecular Approaches to Genetic Improvement]]></conf-name>
<conf-loc>Missouri Kansas City</conf-loc>
<page-range>53-58</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
