<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>0535-5133</journal-id>
<journal-title><![CDATA[Investigación Clínica]]></journal-title>
<abbrev-journal-title><![CDATA[Invest. clín]]></abbrev-journal-title>
<issn>0535-5133</issn>
<publisher>
<publisher-name><![CDATA[Instituto de Investigaciones Clínicas "Dr. Américo Negrette", Facultad de Medicina, Universidad del Zulia]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S0535-51332014000200006</article-id>
<title-group>
<article-title xml:lang="es"><![CDATA[Selección de variantes de virus dengue sensibles a la heparina en células BHK-21]]></article-title>
<article-title xml:lang="en"><![CDATA[Selection of heparin-sensitive dengue virus variants in BHK-21 cells]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Celis]]></surname>
<given-names><![CDATA[Argelia]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Moros]]></surname>
<given-names><![CDATA[Zoila]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Gerder]]></surname>
<given-names><![CDATA[Marlene]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Pagano]]></surname>
<given-names><![CDATA[Francesca]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Vizzi]]></surname>
<given-names><![CDATA[Esmeralda]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Liprandi]]></surname>
<given-names><![CDATA[Ferdinando]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Instituto Venezolano de Investigaciones Científicas (IVIC) Centro de Microbiología y Biología Celular Laboratorio Biología de Virus]]></institution>
<addr-line><![CDATA[Caracas ]]></addr-line>
<country>Venezuela</country>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>06</month>
<year>2014</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>06</month>
<year>2014</year>
</pub-date>
<volume>55</volume>
<numero>2</numero>
<fpage>155</fpage>
<lpage>167</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S0535-51332014000200006&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_abstract&amp;pid=S0535-51332014000200006&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://ve.scielo.org/scielo.php?script=sci_pdf&amp;pid=S0535-51332014000200006&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="es"><p><![CDATA[Estudios previos han demostrado que la adaptación de diversos virus a crecer en líneas celulares de vertebrados, conduce a la selección de variantes virales que unen al heparán sulfato (HS) con alta afinidad. En el presente trabajo se determinó la susceptibilidad de cepas del virus dengue (DENV) a la heparina hipersulfatada un análogo al HS, después de pases seriados en células BHK-21. A aislados de campo de los cuatro serotipos de DENV, se les realizaron ocho pases seriados en células BHK-21. La adaptación de los DENV al cultivo celular seleccionó variantes virales con una aumentada capacidad replicativa en células BHK-21 y una incrementada susceptibilidad a la heparina, en relación a las respectivas cepas no adaptadas, obteniéndose una inhibición de la infectividad más significativa en DENV-2 y DENV-4. Las cepas de DENV adaptadas presentaron cambios en la secuencia de aminoácidos de la proteína de envoltura (E), en particular una substitución K204R para DENV-1, N67K para DENV-2, K308R y V452A para DENV-3 y E327G para DENV-4. Estas sustituciones implicaron ganancia de residuos básicos que incrementaron la carga neta positiva de la proteína. Los resultados sugieren, que la adaptación de cepas de DENV a células BHK-21 selecciona variantes virales sensibles a la heparina y que la efectividad de este compuesto varía dependiendo de la cepa viral. Además sugieren que el HS puede jugar un papel importante en la infectividad de las cepas de DENV adaptadas al cultivo celular, a diferencia de los aislados de DENV no adaptados.]]></p></abstract>
<abstract abstract-type="short" xml:lang="en"><p><![CDATA[Several studies have shown that adaptation of various viruses to grow in certain cell lines of vertebrates, leads to the selection of virus variants that bind heparan sulfate (HS) with high affinity. In this study we investigated the susceptibility of strains of dengue virus (DENV) to oversulfated heparin an analogue of HS after passages in BHK-21 cells. Field isolates of the four serotypes of DENV with a limited number of passes in mosquito cells C6/36HT were serially passaged eight times in BHK-21 cells. The adaptation of the DENV to the cell culture selected viral variants with an increased replicative capacity in BHK-21 cells and an increased susceptibility to heparin compared with the original not adapted strains, with a more significant inhibition of the infectivity in DENV-2 and DENV-4.The E protein of the adapted strains showed changes in the amino acid sequence, particularly at the position K204R to DENV-1, N67K to DENV-2, K308R and V452A for DENV-3 and E327G to DENV-4. These substitutions implicated a gain of basic residues that increased the net positive charge of the protein. These results suggest that adaptation of DENV strains to BHK-21 cells implies changes in the envelope protein, changes associated to the protein reactivity with heparin, the inhibitory effectiveness of this compound varying depending on the viral strain. In addition, these results suggest that the HS can play an important role in the infectivity of the DENV strains adapted to vertebrate cell culture, but not in the infectivity of non-adapted DENV isolates.]]></p></abstract>
<kwd-group>
<kwd lng="es"><![CDATA[virus dengue]]></kwd>
<kwd lng="es"><![CDATA[adaptación viral]]></kwd>
<kwd lng="es"><![CDATA[heparina]]></kwd>
<kwd lng="es"><![CDATA[pases seriados]]></kwd>
<kwd lng="es"><![CDATA[células BHK-21]]></kwd>
<kwd lng="en"><![CDATA[dengue virus]]></kwd>
<kwd lng="en"><![CDATA[viral adaptation]]></kwd>
<kwd lng="en"><![CDATA[heparin]]></kwd>
<kwd lng="en"><![CDATA[serial passages]]></kwd>
<kwd lng="en"><![CDATA[BHK-21 cells]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  <BASEFONT SIZE="3"> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="center"><FONT COLOR="#1f1a17" FACE="Verdana"> <B>Selecci&#243;n de variantes de virus dengue sensibles a la heparina en c&#233;lulas  BHK-21.</B></FONT></P> <font size="2" face="Verdana"></font>     <P ALIGN="center"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Argelia Celis<SUP>1,2</SUP>, Zoila Moros<SUP>1</SUP>, Marlene Gerder<SUP>1</SUP>, Francesca Pagano<SUP>1</SUP>, Esmeralda  Vizzi<SUP>1</SUP> y Ferdinando Liprandi<SUP>1</SUP>.</FONT></P>     <P ALIGN="justify"> <FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2"><SUP>1</SUP>Laboratorio Biolog&#237;a de Virus, Centro de Microbiolog&#237;a y Biolog&#237;a Celular,&nbsp; Instituto Venezolano de Investigaciones Cient&#237;ficas (IVIC). Caracas, Venezuela.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2"><SUP>2</SUP>Facultad  de Ciencias de la Salud, Departamento Cl&#237;nico Integral,&nbsp; Escuela de Bioan&#225;lisis,  Universidad de Carabobo. Sede Aragua, La Morita, Venezuela.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Autor de correspondencia: Argelia Celis. Facultad de Ciencias de la Salud,  Departamento Cl&#237;nico Integral, Escuela de Bioan&#225;lisis, Universidad de Carabobo.  Sede Aragua-Venezuela. Final Av. Leonardo Ruiz Pineda, La Morita II, estado  Aragua. Telf: (058) 243-8726376, 0414-4566490. Correo electr&#243;nico: </FONT> <FONT COLOR="#0000ff" FACE="Verdana" SIZE="2"><U><A HREF="mailto:argelia.celis@gmail.com">argelia.celis@gmail.com</A></U></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Resumen.</B> Estudios previos han demostrado que la adaptaci&#243;n de diversos  virus a crecer en l&#237;neas celulares de vertebrados, conduce a la selecci&#243;n  de variantes virales que unen al hepar&#225;n sulfato (HS) con alta afinidad.  En el presente trabajo se determin&#243; la susceptibilidad de cepas del virus  dengue (DENV) a la heparina hipersulfatada un an&#225;logo al HS, despu&#233;s de  pases seriados en c&#233;lulas BHK-21. A aislados de campo de los cuatro serotipos  de DENV, se les realizaron ocho pases seriados en c&#233;lulas BHK-21. La adaptaci&#243;n  de los DENV al cultivo celular seleccion&#243; variantes virales con una aumentada  capacidad replicativa en c&#233;lulas BHK-21 y una incrementada susceptibilidad  a la heparina, en relaci&#243;n a las respectivas cepas no adaptadas, obteni&#233;ndose  una inhibici&#243;n de la infectividad m&#225;s significativa en DENV-2 y DENV-4.  Las cepas de DENV adaptadas presentaron cambios en la secuencia de amino&#225;cidos  de la prote&#237;na de envoltura (E), en particular una substituci&#243;n K204R para  DENV-1, N67K para DENV-2, K308R y V452A para DENV-3 y E327G para DENV-4.  Estas sustituciones implicaron ganancia de residuos b&#225;sicos que incrementaron  la carga neta positiva de la prote&#237;na. Los resultados sugieren, que la  adaptaci&#243;n de cepas de DENV a c&#233;lulas BHK-21 selecciona variantes virales  sensibles a la heparina y que la efectividad de este compuesto var&#237;a dependiendo  de la cepa viral. Adem&#225;s sugieren que el HS puede jugar un papel importante  en la infectividad de las cepas de DENV adaptadas al cultivo celular, a  diferencia de los aislados de DENV no adaptados.</FONT></P> </MULTICOL>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Palabras clave:&nbsp;</B>virus dengue, adaptaci&#243;n viral, heparina, pases seriados, c&#233;lulas BHK-21.</FONT></P> <MULTICOL GUTTER="31" COLS="2"> </MULTICOL> <MULTICOL GUTTER="31" COLS="2"> <font size="2" face="Verdana"></font>     <P ALIGN="center"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Selection of heparin-sensitive dengue virus variants in BHK-21 cells.</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Abstract.</B> Several studies have shown that adaptation of various viruses  to grow in certain cell lines of vertebrates, leads to the selection of  virus variants that bind heparan sulfate (HS) with high affinity. In this  study we investigated the susceptibility of strains of dengue virus (DENV)  to oversulfated heparin an analogue of HS after passages in BHK-21 cells.  Field isolates of the four serotypes of DENV with a limited number of passes  in mosquito cells C6/36HT were serially passaged eight times in BHK-21  cells. The adaptation of the DENV to the cell culture selected viral variants  with an increased replicative capacity in BHK-21 cells and an increased  susceptibility to heparin compared with the original not adapted strains,  with a more significant inhibition of the infectivity in DENV-2 and DENV-4.The  E protein of the adapted strains showed changes in the amino acid sequence,  particularly at the position K204R to DENV-1, N67K to DENV-2, K308R and  V452A for DENV-3 and E327G to DENV-4. These substitutions implicated a  gain of basic residues that increased the net positive charge of the protein.  These results suggest that adaptation of DENV strains to BHK-21 cells implies  changes in the envelope protein, changes associated to the protein reactivity  with heparin, the inhibitory effectiveness of this compound varying depending  on the viral strain. In addition, these results suggest that the HS can  play an important role in the infectivity of the DENV strains adapted to  vertebrate cell culture, but not in the infectivity of non-adapted DENV  isolates.</FONT></P> </MULTICOL>     ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Keywords:&nbsp;</B>dengue virus, viral adaptation, heparin, serial passages, BHK-21 cells.</FONT></P> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Recibido: 27-06-2013. Aceptado: 30-04-2014</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>INTRODUCCI&#211;N</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> El dengue es una enfermedad febril aguda, de etiolog&#237;a viral, transmitida  al hombre por mosquitos del g&#233;nero <I>Aedes</I>, principalmente <I>Aedes aegypti.</I>  Cl&#237;nicamente, la enfermedad puede manifestarse como dengue no grave sin  y con signos de alarma y de una forma m&#225;s severa, la cual puede cursar  con extravasaci&#243;n de plasma, hemorragia severa y compromiso grave de &#243;rganos  (1). Se estima que a nivel mundial, ocurren anualmente entre 50 y 100 millones  de casos de infecciones por dengue y hasta 50.000 muertes cada a&#241;o (2,  3).</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> El agente causal de la enfermedad es el virus dengue (DENV); &#233;ste pertenece  a la familia <I>Flaviviridae </I>del g&#233;nero <I>Flavivirus </I>y posee un genoma de ARN  de cadena sencilla y polaridad positiva de aproximadamente 11 Kb. El viri&#243;n  completo tiene un di&#225;metro aproximado de 50 nm. Presenta una nucleoc&#225;pside  de naturaleza proteica, con simetr&#237;a icosa&#233;drica de 30 nm de di&#225;metro,  que empaqueta al genoma viral. La nucleoc&#225;pside esta revestida por una  envoltura lip&#237;dica de 10 nm de grosor, que contiene dos prote&#237;nas asociadas,  una de membrana (M) y otra de envoltura (E) que reposan paralelamente sobre  la superficie del viri&#243;n&nbsp;(4). El grupo de DENV est&#225; representado por los  serotipos: DENV-1, DENV-2, DENV-3, DENV-4 que est&#225;n relacionados serol&#243;gicamente  pero con caracter&#237;sticas antig&#233;nicas distintas (5, 6) y DENV-5 que recientemente  fue descubierto (7).</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> La prote&#237;na E, constituye la prote&#237;na m&#225;s grande del viri&#243;n (51-59 kD),  es el componente principal de las proyecciones de la superficie del mismo.  Esta prote&#237;na presenta tres dominios; el dominio I, es el dominio central  que organiza la estructura; el dominio II es elongado, contiene el p&#233;ptido  de fusi&#243;n (98 a 111 residuos) y el dominio III presenta una estructura  parecida a inmunoglobulinas y contiene un sitio de uni&#243;n al receptor (382-385  residuos) (8). Al igual que otros virus envueltos, esta prote&#237;na presentan  dos sitios de glicosilaci&#243;n (9) y cumple un papel importante en un n&#250;mero  de actividades biol&#243;gicas incluyendo: ensamblaje viral, uni&#243;n al receptor,  fusi&#243;n de membrana y es el principal blanco para anticuerpos neutralizantes  (10).</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Diferentes prote&#237;nas celulares han sido identificadas como receptores potenciales  para los DENV; sin embargo, hasta el momento no existe una evidencia directa  del papel que juegan &#233;stos durante la entrada en c&#233;lulas hospedadoras y  algunos de los resultados son controversiales (11). Se ha demostrado que  el hepar&#225;n sulfato (HS) un glicosaminoglicano (GAG) altamente sulfatado  est&#225; involucrado en la uni&#243;n y entrada de DENV en c&#233;lulas susceptibles  (12-16). Bas&#225;ndose en el papel del HS, como receptor putativo para DENV,  diferentes investigadores han demostrado, que algunos compuestos poliani&#243;nicos  naturales y sint&#233;ticos que mimetizan al HS, pueden actuar como inhibidores  de la infectividad de DENV en ciertas c&#233;lulas de mam&#237;fero (13, 14, 16-20).</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Recientemente en nuestro laboratorio se evalu&#243; la actividad anti-DENV de  dos compuestos poliani&#243;nicos sulfatados: suramina y heparina hipersulfatada  a diferentes concentraciones (10, 30 y 100 &#181;g/mL). La suramina demostr&#243;  ser un inhibidor eficaz de aislados de campo de los cuatro serotipos de  DENV, mientras que la heparina hipersulfatada no inhibi&#243; la infecci&#243;n de  los DENV en c&#233;lulas BHK-21 (21). Estos resultados sugieren, que DENV podr&#237;a  utilizar mol&#233;culas receptoras distintas al HS para mediar la entrada a  c&#233;lulas BHK-21 o que la susceptibilidad al compuesto sulfatado es dependiente  de la cepa viral utilizada. Se ha demostrado que la adaptaci&#243;n de virus  a crecer en cultivos celulares genera cepas mutantes, que pueden ser usadas  para evaluar diferencias espec&#237;ficas en el uso del receptor entre aislados  originales y cepas de laboratorio (22). Tambi&#233;n se ha demostrado, que la  adaptaci&#243;n de diversos virus incluyendo <I>Flavivirus</I>, al multiplicarse en  ciertas l&#237;neas celulares de vertebrados, conduce a la selecci&#243;n de variantes  virales que unen al HS con alta afinidad (22-24). Un estudio realizado  con el virus de la encefalitis transmitido por garrapatas (TBEV, por sus  siglas en ingl&#233;s) (25), demostr&#243; que los aislamientos originales, son menos  HS dependientes que el virus obtenido luego de pases seriados en c&#233;lulas  BHK-21. Estos virus presentaron varias mutaciones en la superficie de la  prote&#237;na E que crearon &#225;reas nuevas de carga positiva, que probablemente  reaccionan con el HS. En la presente investigaci&#243;n se plante&#243; como objetivo,  determinar la susceptibilidad de varias cepas de DENV, representativas  de cuatro serotipos (DENV-1 a DENV-4), al efecto inhibitorio de un GAG  soluble altamente sulfatado, antes y despu&#233;s de varios pases en c&#233;lulas  BHK-21 e identificar las eventuales mutaciones en la prote&#237;na de envoltura  asociadas al cambio de este fenotipo.</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>MATERIALES Y M&#201;TODOS</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>C&#233;lulas</B></FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C&#233;lulas BHK-21 (ri&#241;&#243;n de h&#225;mster lactante, clon 21, ATCC), c&#233;lulas Vero  (ri&#241;&#243;n de mono verde africano ATCC) y las c&#233;lulas C6/36HT provenientes  de <I>Aedes albopictus </I>(adaptadas a 32&#176;C) se cultivaron en medio 199 (Sigma-Aldrich  St. Louis, Missouri, USA) suplementadas con 10% suero fetal bovino (SFB,  Gibco New York, USA), 2,92% de L-glutamina (Sigma-Aldrich St. Louis, Missouri,  USA), 0,24% de bicarbonato de sodio (Merck, Darmstadt-Alemania), 100.000  UI/L de penicilina s&#243;dica (Pfizer Venezuela, S.A), 2,5 mg/L anfotericina  B (Bristol-Meyers, Squibb, Venezuela) y 80&nbsp;mg/L gentamicina (Laboratorios  Leti. S.A. Venezuela).</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Virus</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Se utilizaron aislados de campo de los cuatro serotipos de DENV que han  circulado en Venezuela en diferentes a&#241;os. La cepa DENV-1 23668 fue cedida  gentilmente por el LARDIDEV, Maracay-Venezuela; las cepas DENV-2 288085,  DENV-3 220034 y DENV-4 220244 fueron cedidas por el Instituto Nacional  de Higiene &#147;Rafael Rangel&#148;, Caracas-Venezuela. Todos los virus fueron recibidos  como un pase temprano (segundo o tercero a partir del plasma del paciente  en c&#233;lulas C6/36HT). Posteriormente, virus de cada serotipo fueron amplificados  en c&#233;lulas C6/36HT (entre 4 y 10 pases) (26), hasta la obtenci&#243;n de t&#237;tulos  virales adecuados para ensayos de infectividad e iniciar pases seriados  en c&#233;lulas BHK-21 (<a href="#TABLA_I">Tabla I</a>).</FONT></P> </MULTICOL>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B><a name="TABLA_I">TABLA I</a></B></FONT></P>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VIRUS DENGUE USADOS EN EL ESTUDIO</FONT></P>     <div align="center"> <TABLE cellspacing="1" width="580" border="1" id="table1"> <TR> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Virus&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A&#241;o aislamiento&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Tipo de c&#233;lula&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> No. de Pases&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Designaci&#243;n&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Título(UFC/mL)&nbsp; </FONT></P> </TD> </TR> <TR> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-1 cepa 23668&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2004&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C6/36HT BHK-21</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 5*&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD1p5 VD1p5BHK8</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 1 &#215; 10<SUP>6</SUP>&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8 &#215; 10</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Caslon224 Bk BT"><FONT COLOR="#1f1a17" FACE="Verdana"><SUP>7</SUP></FONT><FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2">&nbsp;</FONT></FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> </FONT></P> </TD> </TR> <TR> <TD WIDTH="101" VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="LEFT"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-2 cepa 288085&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2008&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C6/36HT BHK-21</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 4*&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD2p4 VD2p4BHK8</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 6 &#215; 10<SUP>5</SUP>&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 5 &#215; 10</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Caslon224 Bk BT"><FONT COLOR="#1f1a17" FACE="Verdana"><SUP>8</SUP></FONT><FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2">&nbsp;</FONT></FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> </FONT></P> </TD> </TR> <TR> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-3 cepa 220034&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2003&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C6/36HT BHK-21</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 10*&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD3p10 VD3p10BHK8</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2 &#215; 10<SUP>6</SUP>&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 4 &#215; 10</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Caslon224 Bk BT"><FONT COLOR="#1f1a17" FACE="Verdana"><SUP>7</SUP></FONT><FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2">&nbsp;</FONT></FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> </FONT></P> </TD> </TR> <TR> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="LEFT"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-4 cepa 220244&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2003&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C6/36HT BHK-21</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 6*&nbsp; </FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8&nbsp; </FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD4p6 VD4p6BHK8</FONT></P> </TD> <TD WIDTH="101" VALIGN="TOP">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 5 &#215; 10<SUP>5</SUP>&nbsp; </FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2 &#215; 10</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Caslon224 Bk BT"><FONT COLOR="#1f1a17" FACE="Verdana"><SUP>8</SUP></FONT><FONT COLOR="#1f1a17" FACE="Verdana" SIZE="2">&nbsp;</FONT></FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> </FONT></P> </TD> </TR> </TABLE> </div>     <P ALIGN="justify" style="margin-left: 20px"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> *Nivel de pases en C6/36 HT del cual se iniciaron los pases en c&#233;lulas  BHK-21.</FONT></P> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Titulaci&#243;n viral</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Los t&#237;tulos de los DENV fueron determinados por ensayo de placa en c&#233;lulas  Vero (27). Las c&#233;lulas crecidas en platos de 24 pozos, fueron infectadas  con 0,2 mL de diluciones seriadas de virus, utilizando como diluyente medio  199 m&#225;s 2% SFB. Cada diluci&#243;n se inocul&#243; por duplicado. Despu&#233;s de dos  horas de incubaci&#243;n a 37&#176;C, a cada pozo se a&#241;adi&#243; 1 mL de de carboximetilcelulosa  (Sigma-Aldrich Co., St Louis, Missouri, EUA) al 1,5% en medio de cultivo  MEM suplementado con 2,5% de SFB (CMC-MEM). Seguidamente los platos se  incubaron a 37&#176;C, entre siete y nueve d&#237;as dependiendo de la cepa. Transcurrido  ese tiempo se procedi&#243; a la fijaci&#243;n de las placas con p-formaldeh&#237;do al  1% (1 g/L diluido en alcohol t&#233;cnico y p-formaldeh&#237;do al 1% diluido en  PBS) durante 15 min y tinci&#243;n con una soluci&#243;n de cristal violeta (Merck,  Darmstadt-Alemania) durante 1 h. Los t&#237;tulos virales fueron calculados  y expresados en unidades formadoras de placa por mililitro (UFP/mL).</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Adaptaci&#243;n de virus dengue  en c&#233;lulas BHK-21</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Para la adaptaci&#243;n de los DENV se realizaron pases seriados de cada serotipo  en c&#233;lulas BHK-21. Cepas virales de cada serotipo, que ten&#237;an un n&#250;mero  limitado de pases (entre 4 y 10) en c&#233;lulas C6/36HT, se multiplicaron en  monocapas de c&#233;lulas BHK-21, inoculadas a una multiplicidad de infecci&#243;n  (m.o.i) de 0,1 UFP/c&#233;lula, seguido por incubaci&#243;n a 37&#176;C por 2 h. Transcurrido  el tiempo de adsorci&#243;n, se agreg&#243; medio de mantenimiento 199 al 5 % SFB  y fueron incubadas a 37&#176;C hasta la aparici&#243;n de efecto citop&#225;tico. Posteriormente,  las suspensiones virales se centrifugaron a 1000 rpm durante 15 min. El  sobrenadante obtenido fue usado para una nueva infecci&#243;n en monocapas de  BHK-21 y as&#237; sucesivamente hasta alcanzar ocho pases (<a href="#TABLA_I">Tabla I</a>). Como control  se utilizaron monocapas de c&#233;lulas BHK-21 sin infectar. Una vez realizado  el &#250;ltimo pase se procedi&#243; a la cuantificaci&#243;n de los t&#237;tulos virales correspondientes  a cada uno de &#233;stos, resultando una m.o.i. utilizada entre 0,1 y 8 UFP/c&#233;lula.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Rendimiento de virus dengue antes  y despu&#233;s de pases en c&#233;lulas BHK-21</B></FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Monocapas de c&#233;lulas BHK-21, fueron cultivadas en placas de seis pozos  e infectadas con los cuatro serotipos de DENV con y sin pases en c&#233;lulas  BHK-21 a un m.o.i. de 1. Despu&#233;s de 2 h de incubaci&#243;n a 37&#176;C, las c&#233;lulas  fueron lavadas y cultivadas en 3 mL de medio 199 al 5% SFB a 37&#176;C por 48  h. Despu&#233;s de este tiempo el sobrenadante fue colectado y el t&#237;tulo viral  fue determinado por ensayo de placa en c&#233;lulas Vero. Los ensayos fueron  realizados por triplicado.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Ensayo de reducci&#243;n de placas</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> La inhibici&#243;n de la infectividad de DENV por la heparina hipersulfatada  (Neoparin Inc. USA) fue estudiada incubando durante 1 h a 37&#176;C, 100 UFP  de los DENV con y sin pases en c&#233;lulas BHK-21, en ausencia y presencia  del compuesto (100&nbsp;&#181;g/mL). Posteriormente, 300 &#181;L de estas mezclas virales  fueron a&#241;adidas a monocapas de c&#233;lulas BHK-21 cultivadas en platos de 12  pozos y procesadas para la obtenci&#243;n de placas. Los resultados se expresaron  como porcentaje de inhibici&#243;n en el n&#250;mero de placas respecto a una muestra  control de virus no incubada con el compuesto y calculado de acuerdo a  la siguiente f&#243;rmula: 100 &#150; (100 X [n&#250;mero de placas formadas en presencia  de la concentraci&#243;n del compuesto/n&#250;mero de placas del control]). Los ensayos  fueron realizados por triplicados para al menos dos experimentos independientes.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>An&#225;lisis de secuencias</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Extracci&#243;n del ARN:</B> El ARN viral se extrajo a partir de al&#237;cuotas de 140  &#181;L de sobrenadante de cultivo de cada uno de los serotipos de DENV adaptado  o no a c&#233;lulas BHK-21, empleando el QIAamp&#174; Viral RNA mini kit (Qiagen,  Alemania), siguiendo las instrucciones del fabricante.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Transcripci&#243;n reversa: </B>Con el ARN viral extra&#237;do se prepar&#243; una mezcla  de reacci&#243;n con la enzima Transcriptasa Reversa Super Script II (Invitrogen)  para generar un ADNc. La mezcla de reacci&#243;n incluy&#243;: 20&nbsp;&#181;L de ARN, 0,5 mM  de cada uno de los deoxinucle&#243;tidostrifosfato (dNTPs), 1 &#181;g/&#181;L de radom  primer (Invitrogen) y agua hasta completar 30 &#181;L de reacci&#243;n. Esta mezcla  se incub&#243; a 65&#176;C por 5 min, para luego enfriar sobre hielo. Finalmente  se le agreg&#243; 0,01 M DTT, RNaseOUTtm (Invitrogen), 100U de 5X first strand  buffer (250&nbsp;mM, Tris-HCl, 375 mM KCl, 15 mM MgCl, Invitrogen) obteni&#233;ndose  un volumen final de 50 &#181;L de mezcla de reacci&#243;n. Seguidamente la mezcla  fue incubada a 42&#176;C durante 90 min y luego inactivada por calentamiento  a 72&#176;C durante 15 min.</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Reacci&#243;n en cadena de la polimerasa (PCR)</B>: Para la amplificaci&#243;n del gen  completo de envoltura (E), se dise&#241;aron cebadores espec&#237;ficos para cada  serotipo usando el programa DNAMAN versi&#243;n 5.2.2 (Lynnon Boiosoft, Quebec,  Canada) (<a href="#TABLA_II">Tabla&nbsp;II</a>). As&#237; 6 &#181;L de ADNc se a&#241;adieron a una mezcla de reacci&#243;n  de 50 &#181;L que conten&#237;a 0,3 mM de cada dNTPs, 1 mM MgSO4, 0,3 mM cada uno  de los cebadores sentido y antisentido, buffer de amplificaci&#243;n provisto  por la casa comercial Invitrogen y 2,5&nbsp;U/&#181;L Platinum&#174; Pfx (Invitrogen).  La mezcla fue colocada en un termociclador modelo PTC-200 (MJ Research,  Inc., Waltham, Mass USA) y sometida a 35 ciclos de desnaturalizaci&#243;n (94&#176;C  &#215; 30 s), hibridizaci&#243;n o anillamiento (60&#176;C &#215; 90 s) y extensi&#243;n (68&#176;C &#215;  2 min). Los productos de PCR fueron analizados por electroforesis en gel  de agarosa al 1%, te&#241;idos con bromuro de etidio (1 &#181;g/&#181;L, Sigma Sigma-Aldrich  Co., St Louis, Missouri, EUA) y visualizados en un transluminador de luz  UV (Bio-rad Laboratories, Richmond, California EUA).</FONT></P> </MULTICOL>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B><a name="TABLA_II">TABLA II</a></B></FONT></P>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> LISTA DE CEBADORES DISE&#209;ADOS Y UTILIZADOS PARA LA AMPLIFICACI&#211;N  DEL GEN DE LA PROTE&#205;NA DE ENVOLTURA (E) DE LOS VIRUS DENGUE</FONT></P>     <div align="center"> <TABLE cellspacing="1" width="579" border="1" id="table2"> <TR> <TD WIDTH="87" VALIGN="TOP" BGCOLOR="#c3c3c2">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> *Nombre del cebador</FONT></P> </TD> <TD WIDTH="273" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Secuencia (5’-3’)</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> **Posici&#243;n cebador en el genoma (nt)</FONT></P> </TD> <TD WIDTH="83" VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Tama&#241;o del producto (pb)</FONT></P> </TD> </TR> <TR> <TD WIDTH="87" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D1- 603-S</FONT></P>     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D1-2600-AS</FONT></P> </TD> <TD WIDTH="273" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> CGTTGACTGCTGGTGTAATGCC</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> TGGCTGATCGAATTCCACAC</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 603-625</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2581-2600</FONT></P> </TD> <TD WIDTH="83" VALIGN="TOP" BGCOLOR="#ffffff">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 1997</FONT></P> </TD> </TR> <TR> <TD WIDTH="87" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D2-614-S</FONT></P>     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D2-2602-AS</FONT></P> </TD> <TD WIDTH="273" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> GTCCACATGGGTAACTTATG</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> TTACTGAGCGGATTCCACAGATGCC</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 614-633</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2578-2602</FONT></P> </TD> <TD WIDTH="83" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 1988</FONT></P> </TD> </TR> <TR> <TD WIDTH="87" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D3-603-S</FONT></P>     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D3-2576-AS</FONT></P> </TD> <TD WIDTH="273" VALIGN="TOP" BGCOLOR="#ffffff">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> GCAACCTCACATCAACATGG</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> CACTCCATTCTCCCAAGCG</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 603-622</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2558-2576</FONT></P> </TD> <TD WIDTH="83" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 1973</FONT></P> </TD> </TR> <TR> <TD WIDTH="87" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D4-399-S</FONT></P>     <P ALIGN="LEFT" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> D4-2519-AS</FONT></P> </TD> <TD WIDTH="273" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> TCAACGATAACATTGCTGTGCTTGATTCCC</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> TTTGTACTGTTCTGTCCAAGTGTGC</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 399-428</FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2495-2519</FONT></P> </TD> <TD WIDTH="83" VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2120</FONT></P> </TD> </TR> </TABLE> </div>     <P ALIGN="justify" style="margin-left: 20px"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> * Los nombres de los oligonucle&#243;tidos con una S indican orientaci&#243;n en  el sentido del genoma y con AS indican antisentido u orientaci&#243;n complementaria  y reversa. ** Las posiciones de las regiones amplificadas est&#225;n basadas  de acuerdo a las secuencias en GenBank de las cepas de DENV-1: EU482611.1,  DENV-2: EU482608.1, DENV-3: EU529683.1, DENV-4: FJ882592.1</FONT></P> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Secuenciaci&#243;n: </B>Los fragmentos de ADN purificados fueron sometidos a una  secuenciaci&#243;n automatizada, utilizando el servicio comercial de secuenciaci&#243;n  (Macrogen, Se&#250;l, Corea). Las secuencias nucleot&#237;dicas fueron analizadas  y editadas utilizando el programa DNAMAN versi&#243;n 5.2.2 (Lynnon Boiosoft,  Quebec, Canada). Para la obtenci&#243;n de los alineamientos de las secuencias  nucleot&#237;dicas y aminoac&#237;dicas se utiliz&#243; el programa de alineamiento de  m&#250;ltiples secuencias CLUSTAL W (28), integrado en el programa MEGA versi&#243;n  4.0 (29).</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>An&#225;lisis estad&#237;stico</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Los datos fueron expresados como medias aritm&#233;ticas &#177; desviaci&#243;n est&#225;ndar.  Las diferencias entre grupos fueron determinadas por la prueba <I>t </I>de Student  usando el programa Excel (Microsoft). Los valores de <I>p</I>&lt;0,05 fueron considerados  estad&#237;sticamente significativos.</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>RESULTADOS</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Rendimiento viral antes y despu&#233;s  de pases en c&#233;lulas BHK-21</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> En ensayos de crecimiento viral en c&#233;lulas BHK21, se compararon las cantidades  de virus producido por las cepas de los serotipos de DENV adaptadas y no  adaptadas a c&#233;lulas BHK-21. En las cepas adaptadas se observ&#243; un incremento  del rendimiento viral, entre 10 y 1000 veces en relaci&#243;n a la cepa no adaptada  (<a href="#fig1">Fig. 1</a>).</FONT></P>     <P ALIGN="center"><a name="fig1"> <img border="0" src="/img/fbpe/ic/v55n2/art06fig1.gif" width="576" height="451"></a></P>     
]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Inhibici&#243;n de la infecci&#243;n por heparina  hipersulfatada en cepas de virus  dengue adaptadas o no a c&#233;lulas BHK-21</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Para determinar si pases seriados de los DENV en c&#233;lulas BHK-21, seleccionan  variantes virales cuya infectividad es dependiente de la interacci&#243;n con  GAG altamente sulfatado, se utiliz&#243; la heparina hipersulfatada, un GAG  soluble, an&#225;logo estructural del HS, como un inhibidor potencial de la  infectividad de los DENV. Para ello, c&#233;lulas BHK-21, fueron infectadas  con DENV en ausencia y presencia de 100 &#181;g/mL de heparina hipersulfatada.  Los resultados mostraron que los cuatro serotipos de DENV adaptados a c&#233;lulas  BHK-21 tienden a ser m&#225;s susceptibles al compuesto que las cepas no adaptadas  (<a href="#fig2">Fig. 2</a>). Un efecto inhibitorio altamente significativo se observ&#243; con  los serotipos DENV-2 (<I>p</I>=0,00002) y DENV-4 (<I>p</I>=0,001) que fueron inhibidos  12,3 veces (98,6%) y 4,9 veces (77,6%) m&#225;s que las cepas no adaptadas (8  y 15,8%) respectivamente. Mientras los serotipos DENV-1 y DENV-3 fueron  menos sensibles al efecto inhibitorio de la heparina alcanzando una reducci&#243;n  de la infectividad de 68,6% y 45,5% respectivamente.</FONT></P>     <P ALIGN="center"><a name="fig2"> <img border="0" src="/img/fbpe/ic/v55n2/art06fig2.gif" width="419" height="756"></a></P>     
<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>Mutaciones en la prote&#237;na de envoltura de virus dengue resultantes  de la  adaptaci&#243;n en c&#233;lulas BHK-21</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Se determinaron los cambios nucleot&#237;dicos en el gen de la prote&#237;na E de  las cepas de DENV adaptadas a cultivo celular. El an&#225;lisis de secuencia  de la regi&#243;n gen&#243;mica correspondiente al gen E de todos los DENV obtenidos  despu&#233;s de ocho pases en c&#233;lulas BHK-21, revel&#243; la aparici&#243;n de sustituciones  nucleot&#237;dicas, resultantes en uno o dos cambios no conservativos de amino&#225;cidos  en los dominios II y III de la prote&#237;na E (<a href="#TABLA_III">Tabla III</a> y  <a href="#fig3">Fig. 3</a>). El serotipo  1 de DENV present&#243; un cambio de lisina (K) por arginina (R) en la posici&#243;n  204. La cepa DENV-2 seleccion&#243; una mutaci&#243;n asparagina (N) por K en la  posici&#243;n 67, mutaci&#243;n que implic&#243; la p&#233;rdida de un sitio de glicosilaci&#243;n  en el dominio II. DENV-3 seleccion&#243; mutaciones K por R en la posici&#243;n 308  y valina (V) por alanina (A) en posici&#243;n 452. En los aislados de DENV-4  s&#243;lo se seleccion&#243; una mutaci&#243;n que implic&#243; reemplazo de un residuo &#225;cido  por uno b&#225;sico [&#225;cido glut&#225;mico (E) por glicina (G)] en la posici&#243;n 327.</FONT></P> </MULTICOL>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B><a name="TABLA_III">TABLA III</a></B></FONT></P>     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> CAMBIOS EN LA PROTE&#205;NA DE ENVOLTURA (E) DE LOS VIRUS DENGUE RESULTANTES DE  LA ADAPTACI&#211;N A C&#201;LULAS BHK-21</FONT></P>     <div align="center"> <TABLE cellspacing="1" width="580" border="1" id="table3"> <TR> <TD VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Virus&nbsp; </FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Designación * </FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#c3c3c2">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Cambio nucleótido</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> (posición) </FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#c3c3c2">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Cambio aminoácido</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> (posición)</FONT></P> </TD> </TR> <TR> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-1</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD1p5 </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD1p5BHK8</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> G (611)</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> K </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> R (204)</FONT></P> </TD> </TR> <TR> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-2</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD2p4 </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD2p4BHK8</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A (201)</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> N  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> K (67)</FONT></P> </TD> </TR> <TR> <TD BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-3</FONT></P> </TD> <TD BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD3p10 </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD3p10BHK8</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> G (923)</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> T  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> C (1355)</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> K  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> R (308)</FONT></P>     <P ALIGN="CENTER" style="margin-top: 0; margin-bottom: 0"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> V  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A (452)</FONT></P> </TD> </TR> <TR> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> DENV-4</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD4p6 </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> VD4p6BHK8</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     ]]></body>
<body><![CDATA[<P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> A  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> G (980)</FONT></P> </TD> <TD VALIGN="TOP" BGCOLOR="#ffffff">     <P ALIGN="CENTER"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> E  </FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Symbol"> &#174;</FONT><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> G (327)</FONT></P> </TD> </TR> </TABLE> </div>     <P ALIGN="justify" style="margin-left: 20px"> <FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> *P, BHK: n&#250;mero de pases en c&#233;lulas C6/36HT (p) y BHK-21 (BHK).</FONT></P>     <P ALIGN="center" style="margin-left: 0px"><a name="fig3"> <img border="0" src="/img/fbpe/ic/v55n2/art06fig3.gif" width="577" height="489"></a></P> <MULTICOL GUTTER="31" COLS="2"> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     
<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>DISCUSI&#211;N</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Se ha demostrado que los aislamientos originales de DENV son menos HS-dependientes  que el virus obtenido luego de pases seriados en c&#233;lulas BHK-21 (25). En  ensayos preliminares evaluamos la actividad anti-DENV de la heparina hipersulfatada,  empleando diferentes concentraciones (10, 30 y 100 &#181;g/mL) del compuesto,  el cual result&#243; no ser un inhibidor eficaz de la infectividad de aislados  de campo de los cuatro serotipos de DENV en c&#233;lulas BHK-21 (21). En este  estudio se demostr&#243; que la adaptaci&#243;n de los cuatro serotipos de DENV a  la l&#237;nea celular BHK-21, tiende a seleccionar variantes virales susceptibles  a la heparina hipersulfatada a diferencia de sus respectivas cepas no adaptadas  y dicha susceptibilidad es dependiente del serotipo viral, siendo DENV-2  y DENV-4 significativamente m&#225;s susceptibles al compuesto que los serotipos  DENV-1 y DENV-3. Este resultado se corresponde con datos publicados previamente  sobre la inhibici&#243;n diferencial de la infecci&#243;n de los DENV por diversos  polisac&#225;ridos sulfatados, incluyendo heparina y diferentes carragenanos  (30, 31).</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> El incremento observado en la susceptibilidad a la heparina hipersulfatada  de los DENV podr&#237;a estar asociado a la presencia de mutaciones en la prote&#237;na  E, que incrementen la carga neta positiva por ganancia de amino&#225;cidos b&#225;sicos  (R, K y H), lo cual podr&#237;a favorecer la interacci&#243;n con la heparina hipersulfatada.  Al realizar el an&#225;lisis de la prote&#237;na E (495 residuos amino&#225;cidos) de  las cepas de DENV adaptados a c&#233;lulas BHK-21, se observ&#243; que cada una present&#243;  cambios en la secuencia de amino&#225;cidos, observ&#225;ndose mutaciones tanto en  el dominio II y III. Resultados previos por otros autores, han demostrado  que las mutaciones en la prote&#237;na E obtenidas luego de la adaptaci&#243;n pueden  variar entre los tres dominios. Por ejemplo, Lee y col. (32) demostraron  que variantes de DENV-2 seleccionadas despu&#233;s de pases en c&#233;lulas de adenocarcinoma  humanas (SW-13) y en BHK-21 conten&#237;an un n&#250;mero de sustituciones en el  dominio II, pero ninguno en el dominio I o III de la prote&#237;na E. En variantes  de virus TBE seleccionadas luego de pases en c&#233;lulas BHK-21, Mandl y col.  (25) demostraron que las mutaciones adquiridas estuvieron presentes en  cada uno de los tres dominios de la prote&#237;na E.</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> La cepa DENV-1 exhibi&#243; una mutaci&#243;n de un amino&#225;cido en la prote&#237;na E,  donde hubo un reemplazo de un residuo b&#225;sico por otro b&#225;sico (K204R). Esta  misma mutaci&#243;n ha sido tambi&#233;n descrita en una quimera de virus de fiebre  amarilla que llevaba el gen E de DENV-1 y &#233;sta fue asociada con una reducida  virulencia en ratones y primates (33). Por otra parte, la cepa DENV-3 present&#243;  dos sustituciones aminoac&#237;dicas (K308R, V452A), que no implicaron ganancia  de carga positiva lo cual podr&#237;a explicar la ausencia de un aumento significativo  en la susceptibilidad a la heparina.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> En las cepas de DENV-2 y DENV-4, se originaron sustituciones de amino&#225;cidos  en la prote&#237;na E (N67K para DENV-2 y E327G para DENV-4) que implicaron  ganancia de residuos b&#225;sicos, lo cual explicar&#237;a en parte el aumento significativo  en la susceptibilidad a la heparina.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Es importante se&#241;alar, que la sustituci&#243;n de N67K en DENV-2 implic&#243; adem&#225;s  una p&#233;rdida de un sitio de glicosilaci&#243;n. La prote&#237;na E de los flavivirus,  posee dos sitios de glicosilaci&#243;n en el dominio II, asparagina 67 y asparagina  153 (N67 y N153). Se ha sugerido, que la glicosilaci&#243;n de las prote&#237;nas  estructurales de los <I>Flavivirus</I> podr&#237;a jugar un papel importante durante  la morfog&#233;nesis viral, la infectividad y el tropismo (34, 35). Recientemente  se demostr&#243; que el sitio de glicosilaci&#243;n N67 no tiene una importancia  cr&#237;tica para el crecimiento de DENV-2, ya que dependiendo de la sustituci&#243;n  aminoac&#237;dica que se introduzca para abolir ese sitio de glicosilaci&#243;n en  la prote&#237;na E, el crecimiento viral se puede ver afectado (36). Bas&#225;ndonos  en el presente estudio, se pudiera pensar, que la sustituci&#243;n de N por  K en la posici&#243;n 67 en DENV-2 tuvo un efecto compensatorio en ese sitio  de glicosilaci&#243;n, favoreciendo el crecimiento viral luego de los ocho pases  en c&#233;lulas BHK-21, ya que el mismo se increment&#243; 100 veces cuando se compar&#243;  con la cepa no adaptada. Adem&#225;s, el encontrar una mayor inhibici&#243;n en la  infectividad de esta cepa por la heparina hipersulfatada con respecto a  la cepa no adaptada, sugiere que la ganancia de residuos b&#225;sicos en la  posici&#243;n 67 de la prote&#237;na E, pudo favorecer un incremento de la carga  neta positiva y/o alterar la conformaci&#243;n general de la prote&#237;na E, que  permitiera la exposici&#243;n de sitios de uni&#243;n al HS. A trav&#233;s de an&#225;lisis  estructurales de prote&#237;nas que se unen a GAG, Cardin y Weintraub (37) determinaron  secuencias consenso de uni&#243;n al HS, las cuales fueron definidas como XBBBXXBX  o XBBXBX (donde B es un residuo b&#225;sico y X cualquier amino&#225;cido). Una posibilidad  alternativa es que estas sustituciones modifiquen los sitios de uni&#243;n al  HS en la prote&#237;na E, quedando &#233;stos expuestos de manera que fuese m&#225;s accesible  a la heparina.</FONT></P>     ]]></body>
<body><![CDATA[<P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> La p&#233;rdida de un residuo &#225;cido (E327G) en la prote&#237;na E de DENV-4, luego  de la adaptaci&#243;n en c&#233;lulas BHK-21, podr&#237;a explicar el aumento de la susceptibilidad  a la heparina hipersulfatada, debido a un incremento de la carga neta positiva  en la superficie de la prote&#237;na E, que mejorar&#237;a la uni&#243;n a este GAG soluble,  cargado negativamente. Esta misma mutaci&#243;n tambi&#233;n fue descrita por A&#241;ez  y col. (38) en DENV-4, luego de haber sido propagado en c&#233;lulas de pulm&#243;n  fetal de mono Rhesus para la producci&#243;n de vacunas, quien demostr&#243; que  la mutaci&#243;n E327G en DENV-4 aport&#243; un sitio de uni&#243;n para una interacci&#243;n  de alta afinidad del virus a la heparina por incremento de la carga neta  positiva en un &#225;rea localizada en el borde lateral superior del dominio  III de la glicoprote&#237;na E, la cual es accesible a la superficie del viri&#243;n.</FONT></P> </MULTICOL> <MULTICOL GUTTER="31" COLS="2">     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Adicionalmente, en el presente estudio se demostr&#243; que los cuatro serotipos  de DENV incrementaron su rendimiento viral luego de la adaptaci&#243;n a c&#233;lulas  BHK-21. Este hallazgo podr&#237;a ser consecuencia de las mutaciones ocurridas  en la prote&#237;na E, las cuales mejorar&#237;an la eficiencia de la replicaci&#243;n  viral en las c&#233;lulas de cultivo. Sin embargo, no se puede descartar la  ocurrencia de mutaciones en otros genes virales, no analizados en el presente  estudio, que afecten la eficiencia de la replicaci&#243;n.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Es importante resaltar, que el n&#250;mero de pases realizados a los cuatro  serotipos de DENV en c&#233;lulas BHK-21, fue el resultado de la aparici&#243;n de  un efecto citop&#225;tico marcado y reproducible, por lo que se consider&#243; que  ocho pases asegurar&#237;an una selecci&#243;n de variantes virales mejor adaptadas  en cada caso. Hecho que se confirm&#243; con los resultados presentados aqu&#237;,  los cuales sugieren que la adaptaci&#243;n de cepas de DENV a c&#233;lulas BHK-21,  se acompa&#241;an de mutaciones en la prote&#237;na E, que incrementan la carga neta  positiva por ganancia de amino&#225;cidos b&#225;sicos, lo cual podr&#237;a favorecer  la interacci&#243;n del virus con la heparina hipersulfatada, resultando en  una inhibici&#243;n de la infectividad en c&#233;lulas BHK-21. Considerando que la  heparina es un an&#225;logo estructural del HS, estos datos apuntan que el HS  podr&#237;a jugar un papel significativo en la infectividad de las cepas de  DENV adaptadas a esta l&#237;nea celular, a diferencia de los aislados de DENV  no adaptados, los cuales podr&#237;an utilizar mol&#233;culas receptoras distintas  al HS para mediar la entrada a c&#233;lulas BHK-21, teniendo en cuenta que diferentes  prote&#237;nas han sido identificadas como receptores potenciales para los DENV  en diferentes tipos de c&#233;lulas.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>AGRADECIMIENTOS</B></FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> Agradecemos a la Oficina de Planificaci&#243;n del Sector Universitario del  Consejo Nacional de Universidades (OPSU-CNU), Programa de Formaci&#243;n de  Doctores &#147;Alma Mater&#148;, y al programa LOCTI &#147;Caracterizaci&#243;n molecular de  los virus del dengue circulantes en Venezuela&#148; por el financiamiento otorgado  para el desarrollo del presente trabajo.</FONT></P>     <P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> <B>REFERENCIAS</B></FONT></P>     <!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 1.&nbsp;<B>TDR/WHO. </B>Dengue: Guidelines for diagnosis, treatment, prevention and control.  Geneva, Switzerland: World Health Organization (WHO) &amp; Special Programme  for the Research and Training in Tropical Diseases (TDR); 2009.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217891&pid=S0535-5133201400020000600001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 2.&nbsp;<B>Ranjit S, Kissoon N.</B> Dengue hemorrhagic fever and shock syndromes. Pediatr  Crit Care Med 2011; 12(1): 90-100.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217892&pid=S0535-5133201400020000600002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 3.&nbsp;<B>World Health Organization.</B> Dengue and dengue hemorrhagic fever. Factsheet  No. 117. 2012. Disponible en:  <a href="http://www.who.int/mediacentre/factsheets/fs117/en/index.html">http://www.who.int/mediacentre/factsheets/fs117/en/index.html</a>.  Accesado 13 de julio de 2012.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217893&pid=S0535-5133201400020000600003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 4.&nbsp;<B>Kuhn RJ, Zhang W, Rossman MG, Pletnev SV, Corver J, Lenches E, Jones CT,  Mukhopadhyay S, Chipman PR, Strauss EG.</B> Structure of Dengue virus: implications  for flavivirus organization, maturation and fusion. Cell 2002; 108: 717-725.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217894&pid=S0535-5133201400020000600004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 5.&nbsp;<B>Normile D.</B> Surprising new dengue virus throws a spanner in disease control  efforts. Science 2013; 342(6157): 415.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217895&pid=S0535-5133201400020000600005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 6.&nbsp;<B>Monath T, Heinz F.</B> Flavivirus. In: Fields BN, Knipe DM, Howley PM, Eds.Fields  Virology. Philadelphia: Lippincott-Raven Publishers; 1996. P 961-1034.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217896&pid=S0535-5133201400020000600006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 7.&nbsp;<B>Rico-Hesse R.</B> Molecular evolution and distribution of dengue viruses type  1 and 2 in nature. Virology 1990; 174(2): 479-493.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217897&pid=S0535-5133201400020000600007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 8.&nbsp;<B>Crill WD, Roehrig JT.</B> Monoclonal antibodies that bind to domain III of  dengue virus E glycoprotein are the most efficient blockers of virus adsorption  to Vero cell. J Virol 2001; 75: 7769-7773.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217898&pid=S0535-5133201400020000600008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 9.&nbsp;<B>Smith GW, Wright PJ.</B> Synthesis of proteins and glycoproteins in dengue  type 2 virus infected Vero and <I>Aedes albopictus</I> cell. J Gen Virol 1985;  66: 559-571.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217899&pid=S0535-5133201400020000600009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 10.&nbsp;<B>Heinz FX.</B> Epitope mapping of flavivirus glycoproteins. Adv Vir Res 1986;  31:103-168.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217900&pid=S0535-5133201400020000600010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 11.&nbsp;<B>Lindenbach BD, Rice CM.</B> Flaviviridae: The viruses and their replication.  In: Knipe DM, Howley PM, Griffin DE, col., Eds. Fields Virology<I>. </I>Philadelphia:  Lippincott-Williams y Wilkins; 2001. P 991-1041.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217901&pid=S0535-5133201400020000600011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 12.&nbsp;<B>Martinez-Barragan J, Del Angel RM. </B>Identification of a putative coreceptor  on Vero cells that participates in dengue 4 virus infection. J Virol 2001;  75: 7818-7827.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217902&pid=S0535-5133201400020000600012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 13.&nbsp;<B>Chen Y, Maguire T, Hileman RE, Fromm JR, Esko JD, Linhardt RJ, Marks RM.</B>  Dengue virus infectivity depends on envelope protein binding to target  cell heparan sulfate. Nat Med 1997; 3: 866-871.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217903&pid=S0535-5133201400020000600013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 14.&nbsp;<B>Germi R, Crance JM, Garin D, Guimet J, Lortat-Jacob H, Ruigrok RW, Zarski  JP, Drouet E. </B>Heparan sulfate-mediated binding of infectious dengue virus  type 2 and yellow fever virus. Virology 2002; 292:162-168.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217904&pid=S0535-5133201400020000600014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 15.&nbsp;<B>Hilgard P, Stockert R. </B>Heparan sulfate proteoglycans initiate dengue virus  infection of hepatocytes. Hepatology 2000; 32<I>: </I>1069-1077.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217905&pid=S0535-5133201400020000600015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 16.&nbsp;<B>Hung SL, Lee PL, Chen HW, Chen LK, Kao CL, King CC.</B> Analysis of the steps  involved in dengue entry into host cells. Virology 1999; 257:156-167.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217906&pid=S0535-5133201400020000600016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 17.&nbsp;<B>De SF-Tischer PC, Talarico LB, Noseda MD, Guimaraes SMPB, Damonte EB, Duarte  MER. </B>Chemical structure and antiviral activity of carrageenans from <I>Meristiella  gelidium</I>a gainst herpes simplex and dengue virus. Carbohydr Polym 2006;  63: 459-465.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217907&pid=S0535-5133201400020000600017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 18.&nbsp;<B>Pujol CA, Ray S, Damonte EB. </B>Antiviral activity against dengue virus of  diverse classes of algal sulfated polysaccharides. Int J Biol Macromol  2012; 51(4): 412-416.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217908&pid=S0535-5133201400020000600018&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 19.&nbsp;<B>Talarico LB, Duarte MER, Zibetti RGM, Noseda MD, Damonte EB. </B>An algal derived  DL-galactan hybrid is an efficient preventing agent for in vitro dengue  virus infection. Plant Medical 2007; 73: 1464-1468.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217909&pid=S0535-5133201400020000600019&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 20.&nbsp;<B>Thaisomboonsuk BK, Clayson ET, Pantuwatana S, Vaughn DW, Endy TP. </B>Characterization  of dengue-2 virus binding to surfaces of mammalian and insect cells. Am  J Trop Med Hyg 2005; 72: 375-383.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217910&pid=S0535-5133201400020000600020&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 21.&nbsp;<B>Celis A. </B>Papel de los glicosaminoglicanos en las interacciones tempranas  de virus dengue en c&#233;lulas susceptibles. [Tesis Doctoral]. Caracas: Instituto  Venezolano de Investigaciones Cient&#237;ficas (IVIC); 2011.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217911&pid=S0535-5133201400020000600021&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 22.&nbsp;<B>Klimstra WB, Ryman KD, Johnston R.</B> Adaptation of Sindbis virus to BHK cells  selects for use of heparan sulfate as an attachment receptor. J Virol 1998;  72:7357-7366.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217912&pid=S0535-5133201400020000600022&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 23.&nbsp;<B>Lee E, Hall R, Lobigs M. </B>Common E protein determinants for attenuation  of glycosaminoglycan-binding variants of Japanese encephalitis and West  Nile viruses. J Virol 2004; 78: 8271-8280.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217913&pid=S0535-5133201400020000600023&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 24.&nbsp;<B>Lee E, Lobigs M. </B>Mechanism of virulence attenuation of glycosaminoglycan-  binding variants of Japanese encephalitis virus and Murray Valley encephalitis  virus. J Virol 2002; 76: 4901-4911.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217914&pid=S0535-5133201400020000600024&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 25.&nbsp;<B>Mandl CW, Kroschewski H, Allison SL, Kofler R, Holzmann H, Meixner T, Heinz  FX.</B> Adaptation of tick-borne encephalitis virus to BHK-21 cells results  in the formation of multiple heparan sulfate binding sites in the envelope  protein and attenuation in vivo. J Virol 2001; 75: 5627-5637.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217915&pid=S0535-5133201400020000600025&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 26.&nbsp;<B>Roche RR, Alvarez M, Guzman MG, Luis M, Kouri G.</B> Comparison of rapid centrifugation  assay with conventional tissue culture method for isolation of dengue 2  virus in C6/36-HT cells. J Clin Microbiol 2000; 38: 3508-3510.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217916&pid=S0535-5133201400020000600026&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 27.&nbsp;<B>Morens DM, Halstead SB, Repik PM, Putvatana R, Raybourne N.</B> Simplified  plaque reduction neutralization assay for dengue viruses by semi micro  methods in BHK-21 cells: comparison of the BHK suspension test with standard  plaque reduction neutralization. J Clin Microbiol 1985; 22:250-254.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217917&pid=S0535-5133201400020000600027&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 28.&nbsp;<B>Thompson JD, Higgins DG, Gibson TJ. </B>CLUSTAL W: improving the sensitivity  of progressive multiple sequence alignment through sequence weighting,  position-specific gap penalties and weight matrix choice. Nucleic Acids  Res 1994; 22: 4673-4680.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217918&pid=S0535-5133201400020000600028&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 29.&nbsp;<B>Tamura K, Dudley J, Nei M, Kumar S. </B>MEGA4: Molecular Evolutionary Genetics  Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24:1596-1599.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217919&pid=S0535-5133201400020000600029&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 30.&nbsp;<B>Talarico LB, Damonte EB.</B> Interference in dengue virus adsorption and uncoating  by carrageenans. Virology 2007; 363: 473-485.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217920&pid=S0535-5133201400020000600030&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 31.&nbsp;<B>Talarico LB, Pujol C, Zibetti R, Far&#237;a P, Noseda M, Duarte M, Damonte E.  </B>The antiviral activity of sulfated polysaccharides against dengue virus  is dependent on virus serotype and host cell. Antiviral Res 2005; 66: 103-110.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217921&pid=S0535-5133201400020000600031&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 32.&nbsp;<B>Lee E, Wright P, Davidson A, Lobigs M. </B>Virulence attenuation of Dengue  virus due to augmented glycosaminoglycan-binding affinity and restriction  in extraneural dissemination. J Gen Virol 2006; 87: 2791-2801.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217922&pid=S0535-5133201400020000600032&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 33.&nbsp;<B>Guirakhoo FZ, Zhang G, Myers BW, Johnson K, Pugachev R, Nichols N, Brown  N, Lavenbook I, Draper K, Cyrek S, Lang J, Fournier C, Barrere B, Delagrave  S, Monath TP.</B> A single amino acid substitution in the envelope protein  of chimeric yellow fever-dengue 1 vaccine virus reduces neurovirulence  for suckling mice and viremia/viscerotropism for monkeys. J Virol 2004;  78: 9998-10008.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217923&pid=S0535-5133201400020000600033&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 34.&nbsp;<B>Parodi AJ.</B> Protein glucosylation and its role in protein folding. Annu  Rev Biochem 2000; 69: 69-93.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217924&pid=S0535-5133201400020000600034&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 35.&nbsp;<B>Trombetta ES, Helenius A. </B>Lectins as chaperones in glycoprotein folding.  Curr Opin Struct Biol 1998; 8: 587-592.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217925&pid=S0535-5133201400020000600035&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 36.&nbsp;<B>Lee E, Leang S, Davidson A, Lobigs M.</B> Both E protein glycans adversely  affect dengue virus infectivity but are beneficial for virion release.  J Virol 2010; 84: 5171-5180.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217926&pid=S0535-5133201400020000600036&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 37.&nbsp;<B>Cardin A, Weintraub H. </B>Molecular modeling of protein-glycosaminoglycan  interactions. Arteriosclerosis 1989<I>; </I>9: 21-32.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217927&pid=S0535-5133201400020000600037&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 38.&nbsp;<B>A&#241;ez G, Men R, Eckels K, Lai CJ.</B> Passage of dengue virus type 4 vaccine  candidates in fetal rhesus lung cells selects heparin-sensitive variants  that result in loss of infectivity and immunogenicity in rhesus macaques.  J Virol 2009; 83: 10384-10394.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217928&pid=S0535-5133201400020000600038&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><P ALIGN="justify"><FONT COLOR="#1f1a17" SIZE="2" FACE="Verdana"> 39.&nbsp;<B>Modis Y, Ogata S, Clements D, Harrison SC.</B> Structure of the dengue virus  envelope protein after membrane fusion. Nature 2004; 427: 313-319.</FONT>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=1217929&pid=S0535-5133201400020000600039&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --> ]]></body>
<back>
<ref-list>
<ref id="B1">
<label>1</label><nlm-citation citation-type="book">
<collab>TDR/WHO</collab>
<source><![CDATA[Dengue: Guidelines for diagnosis, treatment, prevention and control]]></source>
<year>2009</year>
<publisher-loc><![CDATA[Geneva ]]></publisher-loc>
<publisher-name><![CDATA[World Health Organization (WHO) & Special Programme for the Research and Training in Tropical Diseases (TDR)]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B2">
<label>2</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ranjit]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Kissoon]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Dengue hemorrhagic fever and shock syndromes]]></article-title>
<source><![CDATA[Pediatr Crit Care Med]]></source>
<year>2011</year>
<volume>12</volume>
<numero>1</numero>
<issue>1</issue>
<page-range>90-100</page-range></nlm-citation>
</ref>
<ref id="B3">
<label>3</label><nlm-citation citation-type="journal">
<collab>World Health Organization</collab>
<article-title xml:lang="en"><![CDATA[Dengue and dengue hemorrhagic fever]]></article-title>
<source><![CDATA[Factsheet]]></source>
<year>2012</year>
<numero>117</numero>
<issue>117</issue>
</nlm-citation>
</ref>
<ref id="B4">
<label>4</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Kuhn]]></surname>
<given-names><![CDATA[RJ]]></given-names>
</name>
<name>
<surname><![CDATA[Zhang]]></surname>
<given-names><![CDATA[W]]></given-names>
</name>
<name>
<surname><![CDATA[Rossman]]></surname>
<given-names><![CDATA[MG]]></given-names>
</name>
<name>
<surname><![CDATA[Pletnev]]></surname>
<given-names><![CDATA[SV]]></given-names>
</name>
<name>
<surname><![CDATA[Corver]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Lenches]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
<name>
<surname><![CDATA[Jones]]></surname>
<given-names><![CDATA[CT]]></given-names>
</name>
<name>
<surname><![CDATA[Mukhopadhyay]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Chipman]]></surname>
<given-names><![CDATA[PR]]></given-names>
</name>
<name>
<surname><![CDATA[Strauss]]></surname>
<given-names><![CDATA[EG]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Structure of Dengue virus: implications for flavivirus organization, maturation and fusion]]></article-title>
<source><![CDATA[Cell]]></source>
<year>2002</year>
<volume>108</volume>
<page-range>717-725</page-range></nlm-citation>
</ref>
<ref id="B5">
<label>5</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Normile]]></surname>
<given-names><![CDATA[D]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Surprising new dengue virus throws a spanner in disease control efforts]]></article-title>
<source><![CDATA[Science]]></source>
<year>2013</year>
<volume>342</volume>
<numero>6157</numero>
<issue>6157</issue>
<page-range>415</page-range></nlm-citation>
</ref>
<ref id="B6">
<label>6</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Monath]]></surname>
<given-names><![CDATA[T]]></given-names>
</name>
<name>
<surname><![CDATA[Heinz]]></surname>
<given-names><![CDATA[F]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Flavivirus]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Fields]]></surname>
<given-names><![CDATA[BN]]></given-names>
</name>
<name>
<surname><![CDATA[Knipe]]></surname>
<given-names><![CDATA[DM]]></given-names>
</name>
<name>
<surname><![CDATA[Howley]]></surname>
<given-names><![CDATA[PM]]></given-names>
</name>
</person-group>
<source><![CDATA[Fields Virology]]></source>
<year>1996</year>
<page-range>961-1034</page-range><publisher-loc><![CDATA[Philadelphia ]]></publisher-loc>
<publisher-name><![CDATA[Lippincott-Raven Publishers]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B7">
<label>7</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rico-Hesse]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular evolution and distribution of dengue viruses type 1 and 2 in nature]]></article-title>
<source><![CDATA[Virology]]></source>
<year>1990</year>
<volume>174</volume>
<numero>2</numero>
<issue>2</issue>
<page-range>479-493</page-range></nlm-citation>
</ref>
<ref id="B8">
<label>8</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Crill]]></surname>
<given-names><![CDATA[WD]]></given-names>
</name>
<name>
<surname><![CDATA[Roehrig]]></surname>
<given-names><![CDATA[JT]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Monoclonal antibodies that bind to domain III of dengue virus E glycoprotein are the most efficient blockers of virus adsorption to Vero cell]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2001</year>
<volume>75</volume>
<page-range>7769-7773</page-range></nlm-citation>
</ref>
<ref id="B9">
<label>9</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Smith]]></surname>
<given-names><![CDATA[GW]]></given-names>
</name>
<name>
<surname><![CDATA[Wright]]></surname>
<given-names><![CDATA[PJ]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Synthesis of proteins and glycoproteins in dengue type 2 virus infected Vero and Aedes albopictus cell]]></article-title>
<source><![CDATA[J Gen Virol]]></source>
<year>1985</year>
<volume>66</volume>
<page-range>559-571</page-range></nlm-citation>
</ref>
<ref id="B10">
<label>10</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Heinz]]></surname>
<given-names><![CDATA[FX]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Epitope mapping of flavivirus glycoproteins]]></article-title>
<source><![CDATA[Adv Vir Res]]></source>
<year>1986</year>
<volume>31</volume>
<page-range>103-168</page-range></nlm-citation>
</ref>
<ref id="B11">
<label>11</label><nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lindenbach]]></surname>
<given-names><![CDATA[BD]]></given-names>
</name>
<name>
<surname><![CDATA[Rice]]></surname>
<given-names><![CDATA[CM]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Flaviviridae: The viruses and their replication]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Knipe]]></surname>
<given-names><![CDATA[DM]]></given-names>
</name>
<name>
<surname><![CDATA[Howley]]></surname>
<given-names><![CDATA[PM]]></given-names>
</name>
<name>
<surname><![CDATA[Griffin]]></surname>
<given-names><![CDATA[DE]]></given-names>
</name>
</person-group>
<source><![CDATA[Fields Virology]]></source>
<year>2001</year>
<page-range>991-1041</page-range><publisher-loc><![CDATA[Philadelphia ]]></publisher-loc>
<publisher-name><![CDATA[Lippincott-Williams y Wilkins]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B12">
<label>12</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Martinez-Barragan]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Del Angel]]></surname>
<given-names><![CDATA[RM]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Identification of a putative coreceptor on Vero cells that participates in dengue 4 virus infection]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2001</year>
<volume>75</volume>
<page-range>7818-7827</page-range></nlm-citation>
</ref>
<ref id="B13">
<label>13</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Chen]]></surname>
<given-names><![CDATA[Y]]></given-names>
</name>
<name>
<surname><![CDATA[Maguire]]></surname>
<given-names><![CDATA[T]]></given-names>
</name>
<name>
<surname><![CDATA[Hileman]]></surname>
<given-names><![CDATA[RE]]></given-names>
</name>
<name>
<surname><![CDATA[Fromm]]></surname>
<given-names><![CDATA[JR]]></given-names>
</name>
<name>
<surname><![CDATA[Esko]]></surname>
<given-names><![CDATA[JD]]></given-names>
</name>
<name>
<surname><![CDATA[Linhardt]]></surname>
<given-names><![CDATA[RJ]]></given-names>
</name>
<name>
<surname><![CDATA[Marks]]></surname>
<given-names><![CDATA[RM]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate]]></article-title>
<source><![CDATA[Nat Med]]></source>
<year>1997</year>
<volume>3</volume>
<page-range>866-871</page-range></nlm-citation>
</ref>
<ref id="B14">
<label>14</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Germi]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Crance]]></surname>
<given-names><![CDATA[JM]]></given-names>
</name>
<name>
<surname><![CDATA[Garin]]></surname>
<given-names><![CDATA[D]]></given-names>
</name>
<name>
<surname><![CDATA[Guimet]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Lortat-Jacob]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
<name>
<surname><![CDATA[Ruigrok]]></surname>
<given-names><![CDATA[RW]]></given-names>
</name>
<name>
<surname><![CDATA[Zarski]]></surname>
<given-names><![CDATA[JP]]></given-names>
</name>
<name>
<surname><![CDATA[Drouet]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Heparan sulfate-mediated binding of infectious dengue virus type 2 and yellow fever virus]]></article-title>
<source><![CDATA[Virology]]></source>
<year>2002</year>
<volume>292</volume>
<page-range>162-168</page-range></nlm-citation>
</ref>
<ref id="B15">
<label>15</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Hilgard]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Stockert]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Heparan sulfate proteoglycans initiate dengue virus infection of hepatocytes]]></article-title>
<source><![CDATA[Hepatology]]></source>
<year>2000</year>
<volume>32</volume>
<page-range>1069-1077</page-range></nlm-citation>
</ref>
<ref id="B16">
<label>16</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Hung]]></surname>
<given-names><![CDATA[SL]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[PL]]></given-names>
</name>
<name>
<surname><![CDATA[Chen]]></surname>
<given-names><![CDATA[HW]]></given-names>
</name>
<name>
<surname><![CDATA[Chen]]></surname>
<given-names><![CDATA[LK]]></given-names>
</name>
<name>
<surname><![CDATA[Kao]]></surname>
<given-names><![CDATA[CL]]></given-names>
</name>
<name>
<surname><![CDATA[King]]></surname>
<given-names><![CDATA[CC]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Analysis of the steps involved in dengue entry into host cells]]></article-title>
<source><![CDATA[Virology]]></source>
<year>1999</year>
<volume>257</volume>
<page-range>156-167</page-range></nlm-citation>
</ref>
<ref id="B17">
<label>17</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[De SF-Tischer]]></surname>
<given-names><![CDATA[PC]]></given-names>
</name>
<name>
<surname><![CDATA[Talarico]]></surname>
<given-names><![CDATA[LB]]></given-names>
</name>
<name>
<surname><![CDATA[Noseda]]></surname>
<given-names><![CDATA[MD]]></given-names>
</name>
<name>
<surname><![CDATA[Guimaraes]]></surname>
<given-names><![CDATA[SMPB]]></given-names>
</name>
<name>
<surname><![CDATA[Damonte]]></surname>
<given-names><![CDATA[EB]]></given-names>
</name>
<name>
<surname><![CDATA[Duarte]]></surname>
<given-names><![CDATA[MER]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Chemical structure and antiviral activity of carrageenans from Meristiella gelidiuma gainst herpes simplex and dengue virus]]></article-title>
<source><![CDATA[Carbohydr Polym]]></source>
<year>2006</year>
<volume>63</volume>
<page-range>459-465</page-range></nlm-citation>
</ref>
<ref id="B18">
<label>18</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Pujol]]></surname>
<given-names><![CDATA[CA]]></given-names>
</name>
<name>
<surname><![CDATA[Ray]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Damonte]]></surname>
<given-names><![CDATA[EB]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Antiviral activity against dengue virus of diverse classes of algal sulfated polysaccharides]]></article-title>
<source><![CDATA[Int J Biol Macromol]]></source>
<year>2012</year>
<volume>51</volume>
<numero>4</numero>
<issue>4</issue>
<page-range>412-416</page-range></nlm-citation>
</ref>
<ref id="B19">
<label>19</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Talarico]]></surname>
<given-names><![CDATA[LB]]></given-names>
</name>
<name>
<surname><![CDATA[Duarte]]></surname>
<given-names><![CDATA[MER]]></given-names>
</name>
<name>
<surname><![CDATA[Zibetti]]></surname>
<given-names><![CDATA[RGM]]></given-names>
</name>
<name>
<surname><![CDATA[Noseda]]></surname>
<given-names><![CDATA[MD]]></given-names>
</name>
<name>
<surname><![CDATA[Damonte]]></surname>
<given-names><![CDATA[EB]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[An algal derived DL-galactan hybrid is an efficient preventing agent for in vitro dengue virus infection]]></article-title>
<source><![CDATA[Plant Medical]]></source>
<year>2007</year>
<volume>73</volume>
<page-range>1464-1468</page-range></nlm-citation>
</ref>
<ref id="B20">
<label>20</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Thaisomboonsuk]]></surname>
<given-names><![CDATA[BK]]></given-names>
</name>
<name>
<surname><![CDATA[Clayson]]></surname>
<given-names><![CDATA[ET]]></given-names>
</name>
<name>
<surname><![CDATA[Pantuwatana]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Vaughn]]></surname>
<given-names><![CDATA[DW]]></given-names>
</name>
<name>
<surname><![CDATA[Endy]]></surname>
<given-names><![CDATA[TP]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Characterization of dengue-2 virus binding to surfaces of mammalian and insect cells]]></article-title>
<source><![CDATA[Am J Trop Med Hyg]]></source>
<year>2005</year>
<volume>72</volume>
<page-range>375-383</page-range></nlm-citation>
</ref>
<ref id="B21">
<label>21</label><nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Celis]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
</person-group>
<source><![CDATA[Papel de los glicosaminoglicanos en las interacciones tempranas de virus dengue en células susceptibles]]></source>
<year></year>
</nlm-citation>
</ref>
<ref id="B22">
<label>22</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Klimstra]]></surname>
<given-names><![CDATA[WB]]></given-names>
</name>
<name>
<surname><![CDATA[Ryman]]></surname>
<given-names><![CDATA[KD]]></given-names>
</name>
<name>
<surname><![CDATA[Johnston]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Adaptation of Sindbis virus to BHK cells selects for use of heparan sulfate as an attachment receptor]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>1998</year>
<volume>72</volume>
<page-range>7357-7366</page-range></nlm-citation>
</ref>
<ref id="B23">
<label>23</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
<name>
<surname><![CDATA[Hall]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Lobigs]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Common E protein determinants for attenuation of glycosaminoglycan-binding variants of Japanese encephalitis and West Nile viruses]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2004</year>
<volume>78</volume>
<page-range>8271-8280</page-range></nlm-citation>
</ref>
<ref id="B24">
<label>24</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
<name>
<surname><![CDATA[Lobigs]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Mechanism of virulence attenuation of glycosaminoglycan- binding variants of Japanese encephalitis virus and Murray Valley encephalitis virus]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2002</year>
<volume>76</volume>
<page-range>4901-4911</page-range></nlm-citation>
</ref>
<ref id="B25">
<label>25</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Mandl]]></surname>
<given-names><![CDATA[CW]]></given-names>
</name>
<name>
<surname><![CDATA[Kroschewski]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
<name>
<surname><![CDATA[Allison]]></surname>
<given-names><![CDATA[SL]]></given-names>
</name>
<name>
<surname><![CDATA[Kofler]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Holzmann]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
<name>
<surname><![CDATA[Meixner]]></surname>
<given-names><![CDATA[T]]></given-names>
</name>
<name>
<surname><![CDATA[Heinz]]></surname>
<given-names><![CDATA[FX]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Adaptation of tick-borne encephalitis virus to BHK-21 cells results in the formation of multiple heparan sulfate binding sites in the envelope protein and attenuation in vivo]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2001</year>
<volume>75</volume>
<page-range>5627-5637</page-range></nlm-citation>
</ref>
<ref id="B26">
<label>26</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Roche]]></surname>
<given-names><![CDATA[RR]]></given-names>
</name>
<name>
<surname><![CDATA[Alvarez]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Guzman]]></surname>
<given-names><![CDATA[MG]]></given-names>
</name>
<name>
<surname><![CDATA[Luis]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Kouri]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Comparison of rapid centrifugation assay with conventional tissue culture method for isolation of dengue 2 virus in C6/36-HT cells]]></article-title>
<source><![CDATA[J Clin Microbiol]]></source>
<year>2000</year>
<volume>38</volume>
<page-range>3508-3510</page-range></nlm-citation>
</ref>
<ref id="B27">
<label>27</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Morens]]></surname>
<given-names><![CDATA[DM]]></given-names>
</name>
<name>
<surname><![CDATA[Halstead]]></surname>
<given-names><![CDATA[SB]]></given-names>
</name>
<name>
<surname><![CDATA[Repik]]></surname>
<given-names><![CDATA[PM]]></given-names>
</name>
<name>
<surname><![CDATA[Putvatana]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Raybourne]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Simplified plaque reduction neutralization assay for dengue viruses by semi micro methods in BHK-21 cells: comparison of the BHK suspension test with standard plaque reduction neutralization]]></article-title>
<source><![CDATA[J Clin Microbiol]]></source>
<year>1985</year>
<volume>22</volume>
<page-range>250-254</page-range></nlm-citation>
</ref>
<ref id="B28">
<label>28</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Thompson]]></surname>
<given-names><![CDATA[JD]]></given-names>
</name>
<name>
<surname><![CDATA[Higgins]]></surname>
<given-names><![CDATA[DG]]></given-names>
</name>
<name>
<surname><![CDATA[Gibson]]></surname>
<given-names><![CDATA[TJ]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice]]></article-title>
<source><![CDATA[Nucleic Acids Res]]></source>
<year>1994</year>
<volume>22</volume>
<page-range>4673-4680</page-range></nlm-citation>
</ref>
<ref id="B29">
<label>29</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Tamura]]></surname>
<given-names><![CDATA[K]]></given-names>
</name>
<name>
<surname><![CDATA[Dudley]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Nei]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Kumar]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0]]></article-title>
<source><![CDATA[Mol Biol Evol]]></source>
<year>2007</year>
<volume>24</volume>
<page-range>1596-1599</page-range></nlm-citation>
</ref>
<ref id="B30">
<label>30</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Talarico]]></surname>
<given-names><![CDATA[LB]]></given-names>
</name>
<name>
<surname><![CDATA[Damonte]]></surname>
<given-names><![CDATA[EB]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Interference in dengue virus adsorption and uncoating by carrageenans]]></article-title>
<source><![CDATA[Virology]]></source>
<year>2007</year>
<volume>363</volume>
<page-range>473-485</page-range></nlm-citation>
</ref>
<ref id="B31">
<label>31</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Talarico]]></surname>
<given-names><![CDATA[LB]]></given-names>
</name>
<name>
<surname><![CDATA[Pujol]]></surname>
<given-names><![CDATA[C]]></given-names>
</name>
<name>
<surname><![CDATA[Zibetti]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Faría]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Noseda]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Duarte]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Damonte]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The antiviral activity of sulfated polysaccharides against dengue virus is dependent on virus serotype and host cell]]></article-title>
<source><![CDATA[Antiviral Res]]></source>
<year>2005</year>
<volume>66</volume>
<page-range>103-110</page-range></nlm-citation>
</ref>
<ref id="B32">
<label>32</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
<name>
<surname><![CDATA[Wright]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Davidson]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
<name>
<surname><![CDATA[Lobigs]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Virulence attenuation of Dengue virus due to augmented glycosaminoglycan-binding affinity and restriction in extraneural dissemination]]></article-title>
<source><![CDATA[J Gen Virol]]></source>
<year>2006</year>
<volume>87</volume>
<page-range>2791-2801</page-range></nlm-citation>
</ref>
<ref id="B33">
<label>33</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Guirakhoo]]></surname>
<given-names><![CDATA[FZ]]></given-names>
</name>
<name>
<surname><![CDATA[Zhang]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
<name>
<surname><![CDATA[Myers]]></surname>
<given-names><![CDATA[BW]]></given-names>
</name>
<name>
<surname><![CDATA[Johnson]]></surname>
<given-names><![CDATA[K]]></given-names>
</name>
<name>
<surname><![CDATA[Pugachev]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Nichols]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Brown]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Lavenbook]]></surname>
<given-names><![CDATA[I]]></given-names>
</name>
<name>
<surname><![CDATA[Draper]]></surname>
<given-names><![CDATA[K]]></given-names>
</name>
<name>
<surname><![CDATA[Cyrek]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Lang]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Fournier]]></surname>
<given-names><![CDATA[C]]></given-names>
</name>
<name>
<surname><![CDATA[Barrere]]></surname>
<given-names><![CDATA[B]]></given-names>
</name>
<name>
<surname><![CDATA[Delagrave]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Monath]]></surname>
<given-names><![CDATA[TP]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A single amino acid substitution in the envelope protein of chimeric yellow fever-dengue 1 vaccine virus reduces neurovirulence for suckling mice and viremia/viscerotropism for monkeys]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2004</year>
<volume>78</volume>
<page-range>9998-10008</page-range></nlm-citation>
</ref>
<ref id="B34">
<label>34</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Parodi]]></surname>
<given-names><![CDATA[AJ]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Protein glucosylation and its role in protein folding]]></article-title>
<source><![CDATA[Annu Rev Biochem]]></source>
<year>2000</year>
<volume>69</volume>
<page-range>69-93</page-range></nlm-citation>
</ref>
<ref id="B35">
<label>35</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Trombetta]]></surname>
<given-names><![CDATA[ES]]></given-names>
</name>
<name>
<surname><![CDATA[Helenius]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Lectins as chaperones in glycoprotein folding]]></article-title>
<source><![CDATA[Curr Opin Struct Biol]]></source>
<year>1998</year>
<volume>8</volume>
<page-range>587-592</page-range></nlm-citation>
</ref>
<ref id="B36">
<label>36</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[E]]></given-names>
</name>
<name>
<surname><![CDATA[Leang]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Davidson]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
<name>
<surname><![CDATA[Lobigs]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Both E protein glycans adversely affect dengue virus infectivity but are beneficial for virion release]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2010</year>
<volume>84</volume>
<page-range>5171-5180</page-range></nlm-citation>
</ref>
<ref id="B37">
<label>37</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Cardin]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
<name>
<surname><![CDATA[Weintraub]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular modeling of protein-glycosaminoglycan interactions]]></article-title>
<source><![CDATA[Arteriosclerosis]]></source>
<year>1989</year>
<volume>9</volume>
<page-range>21-32</page-range></nlm-citation>
</ref>
<ref id="B38">
<label>38</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Añez]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
<name>
<surname><![CDATA[Men]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Eckels]]></surname>
<given-names><![CDATA[K]]></given-names>
</name>
<name>
<surname><![CDATA[Lai]]></surname>
<given-names><![CDATA[CJ]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Passage of dengue virus type 4 vaccine candidates in fetal rhesus lung cells selects heparin-sensitive variants that result in loss of infectivity and immunogenicity in rhesus macaques]]></article-title>
<source><![CDATA[J Virol]]></source>
<year>2009</year>
<volume>83</volume>
<page-range>10384-10394</page-range></nlm-citation>
</ref>
<ref id="B39">
<label>39</label><nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Modis]]></surname>
<given-names><![CDATA[Y]]></given-names>
</name>
<name>
<surname><![CDATA[Ogata]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Clements]]></surname>
<given-names><![CDATA[D]]></given-names>
</name>
<name>
<surname><![CDATA[Harrison]]></surname>
<given-names><![CDATA[SC]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Structure of the dengue virus envelope protein after membrane fusion]]></article-title>
<source><![CDATA[Nature]]></source>
<year>2004</year>
<volume>427</volume>
<page-range>313-319</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
