Serviços Personalizados
Journal
Artigo
Indicadores
-
Citado por SciELO -
Acessos
Links relacionados
-
Similares em
SciELO
Compartilhar
Investigación Clínica
versão impressa ISSN 0535-5133versão On-line ISSN 2477-9393
Invest. clín v.51 n.3 Maracaibo set. 2010
Hemoglobin S/hemoglobin City of Hope compound heterozygote with a SubSaharan genetic background and severe bone marrow hypoplasia.
Irene Paradisi, Neida González, Alba Hernández and Sergio Arias.
1Laboratorio de Genética Humana, Instituto Venezolano de Investigaciones Científicas (IVIC). Caracas, Venezuela.
Corresponding author: Sergio Arias. Laboratorio de Genética Humana, Instituto Venezolano de Investigaciones Científicas (IVIC). Apartado 21827. Caracas 1020A, Venezuela. Tel. 58-212-5041138. Fax: 58-212-5041086. E-mail: sarias@ivic.gob,ve
Abstract. Hemoglobin City of Hope (Hb CH) (HBB: c.208G>A, beta 69 (E13)Gly>Ser) is a rare, anomalous change. Seven independent carriers reported so far, had not displayed any hematological manifestations. The ethnic origin of the known instances is presumably heterogeneous, although they are mainly Mediterraneans or equatorial West Africans. We describe the case of a compound heterozygote in trans for Hb S (Glu6Val) and Hb City of Hope (Gly69Ser) in an anemic two year-old boy with a severe immune-deficient phenotype and fatal chronic parvovirus B19 infection. Haplotype with the Hb S was Bantu; while it was a mixed atypical Benin/Cameroon for Hb CH. Remote ancestral origin of the City of Hope mutation in this family seems to be SubSaharan African. The compound heterozygosis in trans for hemoglobins S and City of Hope, jointly with an unfavorable HBB control region background and a viral chronic infection, seemed the cause of the fatal outcome in the patient. When accompanied by other Hb deleterious mutations in trans, Hb CH should not be considered any longer as an innocuous or functionally silent variant.
Key words: hemoglobin S, hemoglobin City of Hope, immune deficiency, sickling anemic phenotype, African haplotypes, parvovirus B19.
Heterocigoto compuesto para hemoglobina S/hemoglobina City of Hope con trasfondo genético subsahariano e hipoplasia severa de médula ósea.
Resumen. La hemoglobina City of Hope (Hb CH) (HBB: c.208G>A, beta 69 (E13)Gly>Ser) es una variante infrecuente, considerada como anómala. Ninguno de los siete heterocigotos simples, genéticamente no relacionados, reportados hasta ahora, ha mostrado hemopatología. El origen étnico de esos casos es presuntamente heterogéneo, pero la mayoría parece mediterráneo o africano-ecuatorial occidental. Se describe el caso de un niño de dos años de edad con fenotipo hipoplásico mieloeritroideo severo e infección crónica por parvovirus B19, heterocigoto compuesto en trans para las hemoglobinas S (Glu6Val) y City of Hope (Gly69Ser ). El haplotipo en fase con la Hb S fue Bantú, mientras que el de la Hb CH fue un combinado atípico Benin/Camerún. El origen ancestral remoto de la mutación City of Hope (y de la Hb S) en esta familia es africano subsahariano. La heterocigosis compuesta en trans para las hemoglobinas S y City of Hope y una secuencia génica predisponente en la región de control de HBB, conjuntamente con la infección por parvovirus B19 pueden ser la causa del curso fatal del paciente. En presencia de otras mutaciones de hemoglobina deletéreas, la Hb City of Hope no debiera ser considerada una variante inocua o funcionalmente silenciosa.
Palabras clave: hemoglobina S, hemoglobina City of Hope, deficiencia inmunológica, fenotipo de anemia falciforme, haplotipos africanos, parvovirus B19.
Received: 30-09-2009. Accepted: 25-02-2010.
INTRODUCTION
Hemoglobin City of Hope (Hb CH) (HBB: c.208G>A, beta 69 (E13)Gly>Ser) seems to be a rare β globin variant, which was found initially in Caucasoid families (1, 2); later in a Turkish one (3); in an Italian family from Naples (4); in a Nigerian newborn and his mother in Madrid, Spain (5, 6) and in 2 out of 2105 hemoglobin samples collected along 5 years in Switzerland (7). This functionally silent mutation has been discovered in single heterozygous healthy individuals who had not shown any hematological or clinical manifestations (1-6). The exception is a Turkish patient with βo-thalassemia intermedia and moderate microcytic hypochromic anemia (3), whose normal heterozygous mother carried the Gly69Ser substitution on a β globin-like cluster haplotype I background. In the Italian family the haplotype was IX.
We describe the case of a compound heterozygote in trans for Hb S/Hb City of Hope seen in a two-year old boy referred for diagnosis, who died from a septic shock a year later. His mother, maternal grandmother, aunt and one sister, carried the Hb CH mutation, without any hematological manifestation. His normal father and paternal aunt carried a Hb S chromosome. The maternal City of Hope syntenic associations were ; ; +; ; ; ; ; ; + ; + plus the beta gene promoter 5 untranslated region motif (AC)2(AT)8(T)5 ; and the paternal ones for the Hb S haplotype were respectively ; ; ; ; ; +; +; ; +; + and motif (AC)2(AT)6(T)9.
This report of a β globin compound heterozygote in trans for the Gly69Ser and Hb S (Glu6Val) mutations, displaying a severe anemic phenotype complicated with a fatal parvovirus B19 chronic infection, challenges the quasi-normality hypothesis of the Hb CH mutation of a possibly remote SubSaharan origin.
CASE REPORT
The last child of 3-sibship was born through a Cesarean delivery after a normal 39-week gestation, to a 33 year-old mother and as a healthy 3.4 kg, 50 cm boy. After the first 4 uneventual months he was presented with diarrhea and dehydration, that was successfully treated. One month later, he acquired varicella from his sister and at 6 months, he suffered a pneumococcal meningitis, complicated with a subdural collection and convulsions. At 7 months of age he was found to have anemia, leucopenia, thrombocytopenia and red cell morphologic alterations, but the low MCV and reticulocyte values were atypical for any mixed Hb S /β thalassemia combination (Table I) an enlarged liver and spleen were discovered. The bone marrow was found normal in two consecutive studies. Erythrocytic G6PD and pyruvate kinase were normal. Viral infections (hepatitis B, C, parvovirus, HIV and EBV) were apparently absent, but a high IgM anti-CMV was found; immune studies (complement, immunoglobulins, lymphocyte populations, NBT test) and clotting factors, were all found normal. At 2 years of age he was briefly hospitalized due both, to a severe respiratory infection with bronchoconstriction and to generalized convulsive crises. Brain MRI revealed an improvement of the subdural lesion, which however was producing a cortical irritation not previously curtailed with anticonvulsants. The bone marrow was still normal. Transaminases were increased, and liver and spleen biopsies revealed only reactive hepatitis and congestion, respectively. Lymphocyte populations showed an inverse CD4/ CD8 index, which continued to be so all along his second year. Cytomegalovirus (CMV) antibodies found were of the IgG type, without any IgM and supressor CD8 lymphocytes were the predominant ones. He received several blood transfusions and at 3 years of age he was admitted again with another upper respiratory infection, high fever, leuco-, neutro-, thrombocytopenia and anemia. Enlarged liver and spleen were found and a splenectomy was performed because of a large (694 g) and polysplenic organ. He never suffered from vasoocclusive episodes. A month later the child died at 3.1 years of age with 9.2 kg of weight and 93 cm stature.The autopsy revealed as positive findings a left pleural (250 cc), pericardial (150 cc) and peritoneal (30 cc) effusions, severe myocarditis, subendocardial hemorrhage and ventricular hypertrophy. These were attributed by the pathologist to a non-cytomegalovirus viral infection, later proved to be of parvovirus B19 as the precipitating cause of death, in an immune deficient child.
BLOOD CELL COUNTS AND HEMOGLOBIN ANALYSES IN THE PROPOSITUS DURING HIS FIRST TWO YEARS OF LIFE (n= NUMBER OF INDEPENDENT TESTS)
| Parameter | Age 7-12 months | Age 13-24 months | Control values | ||
| Rangeb | n | Rangeb | n | ||
| WBC (× 103/mm3) | 5.0-5.5 | 6 | 3.8-6.0 | 5 | 5.0-9.5 |
| RBC (× 106/mm3) | 3.3-4.9 | 6 | 3.7-4.15 | 5 | 4.7-6.1 |
| Hb (g/dL) | 7.2-10.9 | 6 | 8.6-9.4 | 5 | 11-14 |
| Hematocrit (%) | 20.3-34.5 | 6 | 26.7-30.4 | 5 | 33-41 |
| MCV (fL) | 56.5-70.2 | 6 | 70.0-72.0 | 3 | 80-94 |
| MCH (pg) | 16.7-25.1 | 6 | 21.4-24.1 | 3 | 27-31 |
| MCHC (g/dL) | 29.5-34.7 | 6 | 30.5-33.2 | 3 | 33-37 |
| Platelets (× 103/mm3) | 184-264 | 6 | 96.0-212 | 5 | 130-400 |
| Ferritin (ng/mL) | - | 332.8 | 1 | 6.9-294 | |
| Anisocytosis | + to +++ | 5 | ++ | 4 | 0 |
| Microcytosis | + | 3 | ++ | 3 | 0 |
| Hypochromia | + | 3 | ++ | 3 | 0 |
| Reticulocytes (%) | 0.1-1.6 | 7 | - | 0.5-2.3 | |
| Hb CHa (%) | 55.6 | 1 | - | 0 | |
| Hb A2 (%) | < 4.3 | 1 | - | 2.1-3.0 | |
| Hb F (%) | 1.7 | 1 | - | < 4.1 | |
| Hb S (%) | 38.4 | 1 | - | 0 | |
a initially mistaken as Hb A. b Values were selected to exclude results within four months of any blood transfusions. (-) : Not measured.
Hemoglobin phenotype
Initial phenotype ascertainment for any hemoglobin with anomalous electrophoretic migration besides Hb S, was done by isoelectrofocusing in 5.05% polyacrylamide gel with ampholyte pH 7-9, according to standard procedures (8).
Stability tests
Isopropanol and heat stability tests were performed according to standard procedures (8).
DNA analysis
DNA was extracted from 5 ml of a venous EDTA anticoagulated blood sample, by a saline method (9), after informed consent of each adult and the granted permission from the parents in the childrens case, according to the bioethical institutional guides. PCR amplification for 81 bases in the 5´untranslated promoter region, exon 1 and part of exon 2 of the beta globin gene (bases 218 to 746, GenBank accession number EF450778) was performed using primers KM29 and RS42 as previously reported (10). Mutant Hb S (Glu6Val) was confirmed with the restriction enzyme Dde I. The β globin codon 2 (C>T) polymorphism (SNP rs713040) was ascertained by restriction digestion of the PCR product with the enzyme Hpy188 I and by sequencing, respectively in both cases.
The single strand conformational polymorphism (SSCP) analysis of the PCR product was done in all the studied family members (10 individuals), in 8% non-denaturing polyacrylamide-bis acrylamide gels (29:1). Bands were visualized by a silver nitrate stain (11).
The complete sequence of the PCR product of those individuals showing anomalous SSCP migration was performed under request in all cases by Macrogen Service, Seoul, Korea.
a-Thalassemia-2 determinants
The ascertainment of the two most common a chain deletions a3.7 and a4.2 was performed according to Baysal and Huisman (12).
Haplotype analysis
The following polymorphic sites of the hemoglobin (beta globin-like) gene cluster on chromosome 11 were analyzed: site 1: 5e (Hinc II); site 2: 5 Gg (Xmn I); site 3: Gg (Hind III) site 4: Ag(Hind III); site 5: yb(Hinc II); site 6: 3 yb (Hinc II); site 7: 5 β (Hinf I); site 8: β (Ava II); site 9: 3 β (Hpa I) and site 10: 3 β (BamH I). PCR amplification for sites 2 to 7 was performed using primers previously reported (13), also for the 5 e site (14). Primers for sites 8 to 10 were designed using Primer 3 Program (http://frodo.wi.mit.edu/) as follows:
Ava II site: 5-TTTCTGGGTTAAGGCA ATAG and 5-CAAGAAAGCGAGCTTA GTGA
Hpa I site: 5-TTAATTATCAACCCAAA GTA and 5-AGCAGGCTGTTCAGTTT CCA (designed on purpose outside the Kpn I long repetitive sequence insertion) (15).
BamH I site: 5-CCTGAGAGAAACAAG CAATG and 5-ATTAGATCCCGTTTGT CCAT.
PCR products were digested with the appropriate restriction endonuclease and the fragments were visualized on 8% polyacrylamide gels.
Beta promoter polymorphism motifs
Primers 5-AGAGCACATTGATTTGTA TTTA and 5AGCTTTGTCTACCATAATTCAG were designed (Primer 3 Program) to study the polymorphic promoter motifs (AC)n (AT)x(T)y (16), including the -551 and -521 SNPs. The structure of each individual motif was assessed by sequencing.
Parvovirus B19 infection
Parvovirus B19 infection was detected by the polymerase chain reaction (PCR) in DNA samples extracted from paraffin-embedded post-mortem tissues (liver, kidney and heart) using primers previously reported (17) and by examining 4µ tissue sections stained with hematoxylin-eosin (17).
RESULTS
Initial hemoglobin phenotyping of the patient at 14 months of age, both by electrophoresis (cellulose acetate, polyacrylamide, acid agar) and isoelectrofocusing, showed him to be an apparent heterozygote Hb A/S, but he had recently received a blood transfusion. A second analysis of a new sample performed several months later showed a less intense band for Hb A and a typical band for Hb S; his father was a heterozygote HbA/S and his mother was an apparent homozygote Hb A/A.
The molecular study of codon 6 of the HBB gene showed the change Glu6Val, corresponding to the Hb S mutation both in one paternal chromosome and in one child chromosome, which his mother and two sisters did not carry.
SSCP analysis of the PCR product including exon 1 and part of exon 2 of the HBB locus showed an anomalous migration pattern in the patient, his mother, one of his sisters (individual code 605, Fig. 1), maternal grandmother and in one of the latter three additional daughters (individual code 507), being different from that of the childrens father. DNA sequencing revealed in all of them, the heterozygous Gly69Ser substitution (GGC®AGC), which corresponded to hemoglobin City of Hope.
Hemoglobin stability tests and hemoglobin F concentration were normal in the grandmother (code 405), mother (code 503) and the patients carriers maternal aunt (code 507) and sister (605). The patient sample was unavailable for those studies, since he had died prematurely, but previous studies had shown no increase in Hb F (Table I).
Haplotypes of the β globin-like gene cluster were assessed; these have been reported as prognostic factors in sickle cell disease (18) and are also useful markers to trace the ethnic origin of the HbS mutation (19, 20). Figure 1 shows haplotype segregation in the family. Haplotype ; ; +; ; ; ; ; ; + ; + in phase with the HbS chromosome, has a Bantu origin (19), except for the () Ava II site, whereas haplotype ; ; ; ; ; +; +; ; +; + , in phase with the Hb CH mutation, seems to be an atypical Benin/Cameroon haplotype (21), with the same exception of the () Ava II site.
Since previous reports of Hb City of Hope carriers have not mentioned it as being a potentially abnormal variant, three additional possible influencing factors were studied which could explain the patients evolution and fatal outcome: common a-thalassemia-2 and β-thalassemia determinants, β-chain promoter silencer motifs and a parvovirus B19 infection.
Neither common a-thalassemia-2 determinants (-a3.7 and -a4.2 deletions) nor β-thalassemia common mutations (changes in codon 39, codon 8 and -27 to -31 upstream bases) were present in the index case, his parents or grandparents and thus, they could not be invoked as concomitant causes for the disease.
The β locus promoter motifs are silencing regulatory sequences to which beta protein 1 (BP1) binds to regulate β globin gene expression (22). Motif (AC)2(AT)7(T)7 is the most common worldwide, being considered the reference sequence (16). Promoter motifs are in allelic disequilibrium with haplotypes of the β globin-like gene cluster (23).
Motif (AC)2(AT)8(T)5 was in cis with Hb CH, whereas (AC)2(AT)6(T)9 was in phase with Hb S (Table II). The (AC)2(AT)8 (T)5 configuration is almost absent from the Mediterranean basin populations and has a frequency of 54.9% in China (22), being also observed in Cameroon Hb S chromosomes, with a T base at -551 position (16). The (AT)6(T)9 motif with a C base at -551 position is in allelic disequilibrium with the Bantu haplotype (22, 23). All the found promoter motif configurations in the Hb CH and the Hb S chromosomes (Table II) support the beta globin-like gene cluster African SubSaharan ethnic origin in the present family. The T base at codon 2 polymorphism (histidine in position 3) present in the grandfather was a useful marker to establish haplotype segregation in this family (Fig. 1).
b GLOBIN PROMOTER POLYMORPHISMS SEGREGATION IN PARENTS AND CHILDREN: MOTIF (AC)n(AT)x(T)y AND -551T>C. CHROMOSOMAL HAPLOTYPE IN EACH INDIVIDUAL IS SEPARATED BY A SLASH; LEFT: PATERNAL; RIGHT: MATERNAL
| Individual code | Motif (AC)n(AT)x(T)y | -551T>C |
| Father (504) | (AC)2(AT)6(T)9 / (AC)2(AT)11(T)7 | C/T |
| Mother (503) | (AC)3(AT)7(T)5 / (AC)2(AT)8(T)5 | T/T |
| Daughter (603) | (AC)2(AT)11(T)7/ (AC)3(AT)7(T)5 | T/T |
| Daughter (605) | (AC)2(AT)11(T)7 /(AC)2(AT)8(T)5 | T/T |
| Index case (602) | (AC)2(AT)6(T)9 /(AC)2(AT)8(T)5 | C/T |
Parvovirus B19 is, predominantly, an erythrophilic virus with a potent inhibitor effect on erythropoiesis, due to its tropism for the dividing erythrocyte precursors. Viral infection destroys immature erythrocytes (reticulocytes) with the resulting decrease in hemoglobin levels. Parvovirus B19 can infect other organs (kidney, heart, liver) causing myocarditis, hepatitis, etc. and several other eventually fatal complications (24). In at least two of the patient post-mortem tissues the virus was present, as demonstrated by the PCR results and the histopathological lesions consisting of nucleolar hypertrophy and brick-red perinuclear staining, which are characteristic findings of parvovirus B19 infection (17, 25).
DISCUSSION
More than 700 structural β globin locus point mutations have been described (26), many of them apparently silent. Little is known about their pathogenic effects in compound heterozygotes; in them, the combination of two substitutions could enhance abnormal consequences of one mutation upon the other, either in the cis or trans configurations in terms of susceptibility to erythrophilic (and other) viral infections. Very scarce information is still available on the regulator influence of the beta gene promoter enhancer or supressor sequences on most of those rare variants. They display quite stratified, but still badly estimated frequencies worldwide.
Ethnic origin of the City of Hope mutation
Hemoglogin City of Hope frequency could have been underestimated so far, since traditional electrophoresis and cation exchange high performance liquid chromatography (HPLC) cannot detect it, and only combined techniques including mass spectrometry can be expected to be totally successful (7). In two independent, more reliable gene frequency estimations done in present-day western Caucasoid European samples, it was found to be around 1/2200 (6, 7). This variant has been reported in different genetic backgrounds from several populations: in two Caucasoids (at least one of them Mediterranean) (1, 2); two other Mediterranean ones (from Turkey and Naples) (3,4) and one SubSaharan West African (from Nigeria) (5, 6). There was no published information about the ethnic origin of the two carriers in Switzerland recently reported (7).
β globin-like gene cluster haplotypes in phase with the City of Hope carrier chromosomes are known only for the Italian and Turkish cases, and now in the family herein reported as well, being them different in each instance. One possible explanation for this difference might be recombinant events between the 5 and 3 subhaplotypes within a 9 Kb interval, an interpretation already suggested for the Italian and Turkish families (4). In our family the 3 subhaplotype is different from those of the other families. Another possibility is a rare de novo mutation in each case, which seems less likely than a recombination event, according to Zago et al. (27). These authors, studying several polymorphic markers (including 7 restriction sites) along the beta-like gene cluster in chromosomes with atypical haplotypes, suggest that those are generated by any of three different mechanisms: isolated nucleotide changes in one of the polymorphic restriction sites, as the negative one we found in all examined family members for the Ava II site; simple or double crossovers between typical βS or βA haplotypes; or gene conversion (27).
The reported Nigerian Hb CH carrier (5) and the present family both have an African background, since the β globin-like gene cluster haplotype in cis in the Venezuelan Hb CH is a mixed Benin/Cameroon one, except again for a () Ava II site. Furthermore, the promoter polymorphic motif (AC)2(AT)8 (T)5 in cis with the City of Hope mutation in this family has been also reported in Cameroon chromosomes (22). This might indicate a very old SubSaharan predominant origin for the mutation, which is apparently unknown so far in non-Mediterranean Caucasoids or in Mongoloids.
Functional analysis of hemoglobin in the compound heterozygote Hb S/Hb CH
Reported single heterozygotes for Hb CH (at least in 8 non-independent individuals from seven independent families) (1-6) lack hematological manifestations; the only compound heterozygote excepted is a Turkish woman with a βo-thalassemia intermedia phenotype (3). Thus presumably the Gly69Ser substitution has no important effects on the β chain functional properties in single heterozygotes. The glycine residue at position 69 is external to the active center and is not involved in the a1β1 or a1β2 interactions in normal tetramers, and has no direct contact with the heme group (1). Neither Hb Rambam (also known as Hb J-Cambridge) a Gly69Asp substitution (28), nor Hb Kenitra, a beta 69 Gly>Arg change associated with an alpha thalassemia show abnormal hematological parameters attributed to the β69 substitution (29).
The three point mutations in the beta chain at codon 69 (City of Hope, Rambam and Kenitra) are the only ones reported to date in the HbVar database (26).
Only one out of seven hemoglobinopathies quoted in that database (26), due to the compound heterozygosity Hb S /Hb X (beta 6 Glu>Val plus other beta mutation) is in trans, as occurred in the Hb S/Hb CH case. Reported mutations flanking codon 69 (3 beta 68 and 4 beta 70) all show either mild clinical manifestations or a severe hemolytic anemia (Hb Mizuho, a beta 68 Leu>Pro mutation) (26). Another unstable low oxygen affinity hemoglobin (Hb Nishinomiya) due to a Leu-Gly insertion between codons 69 and 70 causes spherocytic anemia (30).
Hemoglobin Jamaica Plain (Hb JP, βGlu6Val, Leu68Phe in cis) is a sickling-hemoglobin with markedly reduced oxygen affinity (31); molecular modeling of the compound mutant protein βGlu6Val, Leu68Phe suggested a destabilization of the oxy conformation in Hb JP, due probably to unfavorable steric interactions of the phenylalanine residue within the folded beta globin chain (31). Hb Loves Park (βLeu68Phe , also known as Hb Rockford) has been reported to be a low affinity stable hemoglobin (32).
Thus, it seems that changes in sequences adjacent to codon 69 may have some functional consequences, which could possibly be further enhanced by a Hb S mutation in trans.
Despite the beta 69Gly>Ser substitution being located in the heme pocket region, hemoglobin City of Hope is reputed to be a functionally silent change, and it is electrophoretically indistinguishable from Hb A; however the serine residue has a side chain slightly longer than glycine, and this could cause some steric disturbance in the conformation of the folded molecule. Such a situation might be functionally important and thus symptom-prone, when the beta chain conformation in trans is besides, an abnormal one as is the case with Hb S. It has been shown that the area between residues β66 and the close β73, is an important area of contact between tetramers of the polymer Hb S/Hb X in trans (X being a β-chain variant), affecting polymerization of the hybrid hemoglobin (a2 βS βX ) (33).
In addition to the eventual intrinsic effect of the concurrence of these mutations in trans herein reported, haplotype backgrounds in the beta-like gene cluster (19, 21) and in the beta gene promoter region (16, 22, 23) probably produce important consequences on the severity and course of the phenotype. The Bantu haplotype of the beta globin-like gene cluster in cis with the Hb S mutation in the Venezuelan family may be associated with serious immunodeficiency and sickle cell anemia. This has been formerly attributed (23) to the promoter (AC)2(AT)6(T)9 Bantu configuration, which has the weakest affinity for the repressor BP1 protein, producing a greater beta gene transcription in cis of the abnormal hemoglobin. Since erythrocytic concentration of Hb S is a prime determinant in its intracellular polymerization, the low BP1 repressor effect associated with the Bantu motif could result in an increased beta S chain production. It is a condition that favors polymerization, sickling and red cell destruction, with its ensuing effects (23).
Additionally our index case was homozygous -/- for the Xmn I (-158C>T substitution 5 to Gg) site. Base T at -158 position creates a recognition sequence for Xmn I, which has been associated with a three to eleven fold increase in Gg gene expression (34) and a significant raise in Hb F levels (35), which can ameliorate sickle cell disease manifestations; as expected, Hb F was not raised in our patient.
On the other hand, the (AC)2(AT)8(T)5 Cameroon configuration in cis with the City of Hope mutation has shown high mRNA expression levels in plasmid constructs expressed in transfected murine erythroleukemia cells (16). However, relative synthesis levels of βS and βA mRNAs in heterozygotes are balanced (around 50% of each one) but it is not so for the relative percentage of blood hemoglobin proteins (36), as was observed in the present case which had 55.6% Hb CH and 38.5% Hb S (Table I) at 11 months of age.
Whether this potentially high level of the City of Hope hemoglobin in the patient influenced its interaction with the Hb S in trans, is presently unknown.
Parvovirus B19 infection and compound heterozygosity
This compound heterozygous in trans Hb S /Hb CH patient was apparently healthy during his first 4 months of life. Since then, he suffered repeatedly from different infections; an enlarged liver and spleen were detected already at seven months of age.
Although his hematological parameters were early almost normal; at the age of three years he was suffering from aplastic anemia, dying finally due to an acute cardiac failure and a septic shock. Since he was born in apparent good health and remained so for several months, an external cause seemed to be the precipitating factor for his ailments from then on. The parvovirus B19 infection demonstrated 5 years post-mortem, is an established noxious variable, being most probably in direct relation to the serious cardiac lesions as was proven by both histopathological and viral DNA findings.
It is known that clinical manifestations associated with parvovirus B19 infection depends on the patients immunological and hematological status. In immunocompetent individuals, B19 infection is usually benign. Immunodeficient subjects may become chronically infected, and patients with hematological disorders like sickle cell disease are at high risk of suffering a severe aplastic crisis (37) because B19 infection can suppress erythropoiesis. Furthermore a sickle cell anemic patient has been reported to develop a fulminant myocarditis following a B19-related aplastic crisis (38). This also occurred in our patient who was not however a Hb S/Hb S homozygote, but instead an apparent Hb S/Hb A heterozygote who later was proven to be a compound heterozygote Hb S/unrevealed Hb CH.
This patient is the first reported compound heterozygote in trans for hemoglobins S and City of Hope, jointly with an unfavorable genetic background of a likely African origin from both parental lines in whom a deleterious viral chronic infection precipitated a fatal outcome. The β globin Gly69Ser mutation therefore should not be considered any longer as a functionally silent one, at least in its trans combination with any other known abnormal β globin hemoglobin. This notion would be of great help in the genetic counseling of carrier couples under a similar risk. They are to be considered within the same recurrence risk group as any other pair of single heterozygous carriers at least of hemoglobin S. That should be also the same conclusion in the face of any eventual cross between a single Hb S heterozygous and a homozygous Hb A/Hb A partner not adequately tested for the presence of Hb CH.
ACKNOWLEDGMENTS
To the family, for their efficient continuous cooperation and support. To Carmen Abreu (Inst Anat Pat UCV, Caracas) for her technical assistance with the tissue samples. To Eugenia Arias (FLENI, Buenos Aires, Argentina) for providing us a parvovirus B19 positive paraffin-embedded tissue.
REFERENCES
1. Rahbar S, Asmeron Y and Blume K. A silent hemoglobin variant detected by HPLC: Hemoglobin City of Hope b69 (E13) Gly®Ser. Hemoglobin 1984; 8(4): 333-342. [ Links ]
2. Wilson JB, Chen SS, Webber BB, Kutlar A, Kutlar F, Villegas A, Huisman THJ. The identification of five rare β-chain abnormal hemoglobins by high performance liquid chromatographic procedures. Hemoglobin 1986; 10(1):49-63. [ Links ]
3. Kutlar A, Kutlar M, Aksoy M, Gurgey A, Altay C, Wilson JB, Diaz-Chico JC, Hu H, Huisman THJ. b-thalassemia intermedia in two Turkish families is caused by the interaction of Hb Knossos [β27(B9)Ala®Ser] and of Hb City of Hope [β69 (E13) Gly®Ser] with βo-thalassemia. Hemoglobin 1989; 13(1): 7-16. [ Links ]
4. De Angioletti M, Maglione G, Ferranti P, de Bonis C, Lacerra G, Scarallo A, Pagano L, Fioretti G, Cutolo R, Malorni A, Pucci P, Carestia C. Hb City of Hope [b69 (E13) Gly®Ser ] in Italy: association of the gene with haplotype IX. Hemoglobin 1992; 16(1 & 2):27-34. [ Links ]
5. Hojas Bernal, MR. Incidencia de hemoglobinopatías estructurales en Madrid. Estudio neonatal en sangre de cordón umbilical. (Thesis) Madrid: Universidad Complutense; 2001. [ Links ]
6. González FA, Hojas Bernal, MR, Ropero P, Villegas Martínez A. Aumento de la incidencia de hemoglobinopatías estructurales y talasemia en España. XLIV Reunión Nacional AEHH. Haematologica 2002; 87 (Supl 1):368-372. [ Links ]
7. Kleinert P, Schmid M, Zurbriggen K, Speer O, Schmugge M, Roschitzki B, Durka SS, Leopold U, Kuster T, Heizmann CW, Frischknecht H, Troxler H. Mass spectrometry: a tool for enhanced detection of hemoglobin variants. Clin Chem 2008; 54: 69-76. [ Links ]
8. Efremov GD, Huisman THJ. The laboratory diagnosis of the hemoglobinopathies. Clin Haemat 1974; 3:527-570. [ Links ]
9. Lahiri D, Nurnberger J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acid Res 1991; 19:5444. [ Links ]
10. Saiki RK. Amplification of genomic DNA. In Innis MA, Gelfand DH, Sninsky JJ, White TH eds. PCR protocols: A guide to methods and applications. New York, Academic Press; 1990. P 13-20. [ Links ]
11. Brandt B, Greger V, Yandell D, Passarge E, Horsthemke B. A simple and nonradioactive method for detecting the Rb1.20 DNA polymorphism in the retinoblastoma gene. Am J Hum Genet 1992; 51:1450-1451. [ Links ]
12. Baysal E, Huisman THJ. Detection of common deletional α-thalassemia-2 determinants by PCR. Am J Hematol 1994; 46:208-213. [ Links ]
13. Sutton M, Bouhassira EE, Nagel RL. Polymerase chain reaction amplification applied to the determination of β-like gene cluster haplotypes. Am J Hemat 1989; 32: 66-69. [ Links ]
14. Guerreiro JF, Figueiredo MS, Santos SEB, Zago M. β-Globin gene cluster haplotypes in Yanomama Indians from the Amazon region of Brazil. Hum Genet 1992; 89:629-631. [ Links ]
15. Sheth S, Piomelli S, Wang X. Haplotypes of the human β-like globin gene cluster: analyzing the 3 Hpa I polymorphic site by long distance PCR. Am J Hematol 1995; 50:57-59. [ Links ]
16. Chan PK, Ma ESK, Philipsen S, Tan-Un KC. The study of sequence configuration and functional impact of the (AC)n(AT)x (T)y motif in human β-globin gene promoter. Am J Hematol 2007; 82:342-348. [ Links ]
17. Quemelo PRV, Lima DM, Fonseca BAL, Peres LC. Detection of parvovirus B19 infection in formalin-fixed and paraffin-embedded placenta and fetal tissues. Rev Inst Med Trop S Paulo 2007; 49:103-107. [ Links ]
18. El-Hazmi MAF, Warsy AS, Bashir N, Beshlawi A, Hussain IR, Temtamy S, Qubaili F. Haplotypes of the b-globin gene as prognostic factors in sickle-cell disease. East Mediterr Health J 1999; 5:1154-1158. [ Links ]
19. Antonarakis SE, Boehm CD, Giardina PJ, Kazazian HH. Nonrandom association of polymorphic restriction sites in the β-globin gene cluster. Proc Natl Acad Sci 1982; 79:137-141. [ Links ]
20. Pagnier J, Mears JG, Dunda-Belkhodja O, Schaefer-Rego KE, Beldjord C, Nagel RL, Labie D. Evidence for the multicentric origin of the sickle cell haemoglobin gene in Africa. Proc Natl Acad Sci 1984; 81:1771-1773. [ Links ]
21. Lapouméroulie C, Dunda O, Ducrocq R, Trabuchet G, Mony-Lobé M, Bodo JM, Carnevale P, Labie D, Elion J, Krishnamoorthy R. A novel sickle cell mutation of yet another origin in Africa: the Cameroon type. Hum Genet 1992; 89:333-337. [ Links ]
22. Kalotychou V, Kollia P, Voskaridou E, Patargias T, Anagnou NP, Loukopoulos D. Functional role of the four different types of (AT)X(T)Y motifs 5 to the β-globin gene and their distribution in the Greek population. Blood Cel Mol Dis 2002; 28: 39-46. [ Links ]
23. Elion J, Berg PE, Lapouméroulie C, Trabuchet G, Mittelman M, Krishnamoorthy R, Schechter AN, Labie D. DNA sequence variation in a negative control region 5 to the β-globin gene correlates with the phenotypic expression of the bS mutation. Blood 1992; 79:787-792. [ Links ]
24. Kishore J, Kapoor A. Erythrovirus B19 infection in humans. Indian J Med Res 2000; 112:149-164. [ Links ]
25. Koduri PR. Novel cytomorphology of the giant proerythroblasts of parvovirus B19 infection. Am J Hematol 1998; 58:95-99. [ Links ]
26. Patrinos GP, Giardine B, Riemer C, Miller W, Chui DHK, Anagnou NP, Wajcman H, Hardison RC. Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies. Nucl Acids Res 2004; 32 Database issue: D537-541. (http://globin.cse.psu.edu/hbvar/menu.html). [ Links ]
27. Zago MA, Silva WA, Dalle B, Gualandro S, Hutz MH, Lapouméroulie C, Tavella MH, Araujo AG, Krieger JE, Elion J, Krishnamoorthy R. Atypical bS haplotypes are generated by diverse genetic mechanisms. Am J Hematol 2000; 63:79-84. [ Links ]
28. Sick K, Beale D, Irvine D, Lehmann H, Goodall PT, MacDougall S. Haemoglobin G Copenhagen and haemoglobin J Cambridge. Two new beta-chain variants of haemoglobin A. Biochim Biophys Acta 1967; 140:231-242. [ Links ]
29. Delanoe-Garin J, Arous N, Blouquit Y, Hafsia R, Bardakdjian J, Lacombe C, Rosa J, Galacteros F. Hemoglobin Kenitra alpha 2 beta 2 69 (E13) Gly®Arg. A new beta variant of elevated expression associated with alpha-thalassemia, found in a Moroccan woman. Hemoglobin 1985; 9:1-9. [ Links ]
30. Naito Y, Takahashi T, Matsunashi T, Harano K, Harano T. Hb Nishinomiya [Leu-Gly-inserted between codons 69(E13) and 70(E14) of beta]: a novel unstable hemoglobin with reduced oxygen affinity found in a patient with spherocytic hemolysis. Int J Hematol 2002; 76: 146-148. [ Links ]
31. Geva A, Clark JJ, Zhang Y, Popowicz A, Manning JM, Neufeld EJ. Hemoglobin Jamaica Plain- A sickling hemoglobin with reduced oxygen affinity. N Eng J Med 2004; 351:1532-1538. [ Links ]
32. Ferreira C, Hoyer JD, Miranda A, Picanço I, Almendra V, Seixas MT, Almeida T, Romão L, Faustino P. Hemoglobin Loves Park [beta68 (E12) Leu®Phe]: report of five cases including one originating from a de novo mutation. Am J Hematol 2006; 81:256-261. [ Links ]
33. Nagel RL, Johnson J, Bookchin M, Garel MC, Rosa J, Schiliro G, Wajcman H, Labie D, Moo-Penn W, Castro, O. β-Chain contact sites in the haemoglobin S polymer. Nature 1980; 283: 832-834. [ Links ]
34. Gilman JG, Huisman THJ. DNA sequence variation associated with elevated fetal Gγglobin production. Blood 1985; 66:783-787. [ Links ]
35. Ballas SK, Talacki CA, Adachi K, Schwartz E, Surrey S, Rappaport E. The Xmn I site (-158C®T) 5 to the Gγgene: correlation with the Senegalese haplotype and Gγglobin expression. Hemoglobin 1991; 15:393-405. [ Links ]
36. Dimovski AJ, Efremov DG, Gu LH, Huisman THJ. The relative levels of βA and βS mRNAs in Hb S heterozygotes and in patients with Hb S-β+ -thalassaemia or Hb S-β+ -HPFH combinations. Br J Haem 1994; 87: 353-356. [ Links ]
37. Regaya F, Oussaief L, Bejaoui M, Karoui M, Zili M, Khelifa R. Parvovirus B19 infection in Tunisian patients with sickle-cell anemia and acute erythroblastopenia. BMC Inf Dis 2007; 7:123129. [ Links ]
38. Krishnamurti L, Lanford L, Muñoz R. Life threatening parvovirus B19 and herpes simplex virus associated acute myocardial dysfunction in a child with homozygous sickle cell disease. Pediatr Blood Cancer 2007; 49:1019-1021. [ Links ]














